Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Genomics 2021Quote: ... The larvae were then anaesthetized with 500 μM tricaine (Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich) and livers were microdissected for RNA extraction.
-
bioRxiv - Physiology 2021Quote: ... Lungfish were anesthetized in freshwater containing 0.02% ethyl 3-aminobenzoate methane-sulfonate from Sigma-Aldrich, and tissue samples were quickly dissected and frozen in liquid nitrogen ...
-
bioRxiv - Neuroscience 2021Quote: Larvae were anaesthetised in 0.6mM tricaine/MS-222 (ethyl 3-aminobenzoate methanesulfonate salt, Sigma Aldrich) in HEPES buffered E3 embryo medium and embedded in 1.3-1.5% (w/v ...
-
bioRxiv - Systems Biology 2021Quote: ... were anaesthetised in 0.5% solution of ethyl 3-aminobenzoate methanesulfonate (Sigma-Aldrich, St. Louis, MO) for 15 minutes to separate male and female worms ...
-
bioRxiv - Genomics 2020Quote: ... embryos were anesthetized by adding tricaine (MS222; ethyl-3-aminobenzoate methanesulfonate, #E10521-10G, Sigma-Aldrich) to the medium and selected by the internal positive control of transgenesis ...
-
Computational and functional characterization of the PI(4,5)P2 binding site of the TRPM3 ion channelbioRxiv - Biophysics 2022Quote: ... Frogs were anesthetized in 0.25% ethyl 3-aminobenzoate methanesulfonate solution pH 7.4 (MS222; Sigma-Aldrich), then bags of ovaries were surgically collected from and rotated with 0.1-0.3 mg/ml type 1A collagenase (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Lungfish were anesthetized in freshwater containing 0.02% ethyl 3-aminobenzoate methane-sulfonate from Sigma-Aldrich, and tissue samples were quickly dissected and frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Larvae were anesthetized in E3 water (E3) + 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma) prior to all experiments ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... they were anesthetized using 30 mg/L MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich). The skin tissue was taken from the right side near the back of each individual in approximately 0.8 × 1.0 cm under sterile conditions ...
-
bioRxiv - Developmental Biology 2023Quote: The animals were anesthetized with 0.2% ethyl 3-aminobenzoate methanesulfonate salt (MS-222) (Sigma-Aldrich) for the limb amputation and sampling at various times thereafter ...
-
bioRxiv - Cancer Biology 2024Quote: ... larvae were anesthetized in E3 water containing 0.2 mg/ml Tricaine (ethyl 3-aminobenzoate, Sigma). Larvae were maintained in E3 containing 0.2 mM N-phenylthiourea beginning 1 day post fertilization (dpf ...
-
bioRxiv - Neuroscience 2022Quote: ... Tadpoles were briefly anesthetised in 0.1% MS-222 (Ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, UK) and pinned to a small rotating Sylgard block ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Treated embryos at 3 dpf were anesthetized with 0.025% aminobenzoic acid ethyl ester (tricane, Sigma), and amputated at the posterior edge of the notochord with a 1 mm sapphire blade (World Precision Instruments ...
-
bioRxiv - Developmental Biology 2024Quote: ... the zebrafish were anesthetized with 0.04% Tricaine (ethyl 3-aminobenzoate methanesulfonate salt, #A5040, Sigma, USA) in system water and given i.p ...
-
bioRxiv - Zoology 2024Quote: ... Worms were anesthetized in tricaine (15% ethyl 3-aminobenzoate, methanesulfonic acid salt; Sigma-Aldrich #E10521), and mounted on microscope slides with a 20×20 mm sticker grid with 1mm resolution (ThomasScientific ...
-
bioRxiv - Microbiology 2024Quote: ... larvae were anesthetized in E3 -MB containing 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma). For thermal injury and infection ...
-
bioRxiv - Cell Biology 2024Quote: ... Larvae were anesthetized in E3 water containing 0.2 mg/mL Tricaine (ethyl 3-aminobenzoate, Sigma) prior to experimental procedures ...
-
bioRxiv - Neuroscience 2022Quote: ... or DMSO 0.1% as vehicle was evaluated using a MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) assay as described in (Sanz et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... or cellulose solution in N-hydroxysuccinimide (NHS; Aldrich; 100 mM) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma; 100 mM, 90 min, RT)44 ...
-
bioRxiv - Developmental Biology 2024Quote: ... specifically N-[2-(p-Bromocinnamylamino) ethyl]-5-isoquinolinesulfonamine dihydrochloride (H89, B1427, Sigma-Aldrich), were utilized in this study.
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mM ethyl pyruvate (Sigma #E47808), and 0.4 mM sodium ascorbate (Sigma #11140) ...
-
bioRxiv - Genetics 2021Quote: ... Zebrafish embryos and larvae were anesthetized in 160ug/ml Ethyl 3-aminobenzoate methanesulfonate (Tricaine, MS-222) C9H11NO2·CH4SO3 (Sigma-Aldrich, 886-86-2) in E3 embryo media (Westerfield ...