Labshake search
Citations for Millipore Sigma :
1901 - 1950 of 10000+ citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... and plate three 10 µL droplets of each dilution on plates made of 2% Lennox LB Broth (Sigma Aldrich, St. Louis, Missouri) and 1.5% agar (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was isolated from the base of spruce hypocotyls (5 mm long from 36 to 38 hypocotyl cuttings) using a Spectrum™ Plant Total RNA Kit (Sigma-Aldrich; https://www.sigmaaldrich.com/). cDNA was synthesized using an iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... determined as the amount of 5-bromo-2′-deoxy-uridine (BrdU) incorporation (Roche BrDU Labeling and Detection Kit II, Sigma-Aldrich, St. Louis, MO). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... sterile filtered and used in a Milliplex assay to measure cytokines and chemokines in each sample using a 5- and 25plex customized kit (Millipore and R&D Systems). Data were analyzed by calculating the average value of the biological duplicates and then the ratio of Mtb treated / control ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Physiology 2022Quote: ... Membranes were blocked for 1 hour at room temperature in 5% milk or 5% BSA (Millipore Sigma) in 1X Tris-buffered saline + 0.1% Tween 20 (TBST) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Biochemistry 2019Quote: Clindamycin [CAS: 21462-39-5] and 5-fluorouracil [CAS: 51-21-8] were purchased from Sigma-Aldrich, St ...
-
bioRxiv - Cancer Biology 2021Quote: T-HEp3 cells (P1) growing in a dish were treated with 5 nM 5-Azacytidine (Sigma #A2385) in DMEM containing charcoal-stripped 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM β-mercaptoethanol and incubated for 5 min with 2 mM ATPγS (lithium salt, Sigma Aldrich). 4 µL of this mixture were then applied to the plasma-cleaned grids ...
-
bioRxiv - Neuroscience 2020Quote: ... Trim28-fl(+/− and +/+) animals (Ctl n=5, KO n=5) were put in RIPA buffer (Sigma-Aldrich) containing Protease inhibitor cocktail (PIC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Selected sections were incubated with 5 mg/ml α-amylase for 5 minutes at 37 °C (Sigma) to confirm distinct glycogen and glycoprotein stain localization ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Evolutionary Biology 2020Quote: ... guanosine-15N5 5′-monophosphate (Cat #900380) and guanosine-13C10 5′-triphosphate (Cat #710687) were purchased from Sigma-Adrich (St ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA) (Sigma-Aldrich) for phosphorylated proteins immunoblots in Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Genetics 2022Quote: ... The membrane was hybridized with 5 pmol/ml of a 5’ DIG-labeled (AGAGGG)10 probe (Sigma) in DIG Easy Hybridization Solution (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Sections were then treated 2 times with 5% phosphotungstic acid for 5 minutes each (Sigma Aldrich, P4006), washed 3 times with 100% alcohol ...
-
bioRxiv - Cancer Biology 2019Quote: ... one cells have adhered remove culture medium and replace with diluted lentiviral media (500µl lentiviral media, 1.5ml DMEM, 10% FCS, 5% PenStrep, 5-10µg Polybrene (Sigma)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% LPDS: DMEM containing 1x PenStrep and supplemented with 5% (v/v) LPDS (Sigma Aldrich, USA, S5394).
-
bioRxiv - Molecular Biology 2021Quote: ... 5% Glycerol) supplemented with 1 mM Phenylmethylsulfonyl fluoride (Carl Roth) and 5 mM β-Mercaptoethanol (Sigma Aldrich). The resuspended cells were disrupted by sonication with a Branson Digital Sonifier (Model 102C ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were blocked in PBS 1X containing 5% Normal Horse Serum and 5% bovine albumin (Sigma-Aldrich) for 1h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 5 µl samples were injected onto a ZIC-pHILIC column (150 mm × 2.1 mm; i.d. 5 µm) with a guard column (20 mm × 2.1 mm; i.d. 5 µm) (Millipore) for LC separation ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×104 human MDMs or murine (NSG) BMDMs were co-cultured with 5×104 PKH26-labeled (Sigma) tumor cells in the presence of the different recombinant SiRPα decoys at 10ug/ml in serum-free medium in 96-well ultra-low adherent plates (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×104 human MDMs or murine (NSG) BMDMs were co-cultured with 5×104 PKH26-labeled (Sigma) tumor cells in serum-free medium in 96-well ultra-low adherent plates (Corning ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA) (Sigma-Aldrich) in Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... in PBS) was combined with 5 µL of 5% N,N,N’,N’-tetramethylethylenediamine (TEMED) (Sigma, T9281) and 5 µL of 5% ammonium persulfate (APS ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 µL of the supernatant were either mixed to 5 µL of trehalase (Sigma T8778-1UN) diluted in trehalase buffer (described above ...
-
bioRxiv - Neuroscience 2024Quote: ... Rapamycin was diluted in 5% polyethylene glycol-400 (PEG400, Fluka) and 5% Tween®80 (Sigma-Aldrich) in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... After destaining, the blots were blocked with 5% skim milk (Himedia, #M530) or 5% BSA (Sigma, #A7906) for Phospho-proteins for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were incubated with 0.5mg/ml MTT (SIGMA #M2128) for 3 hours at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: Luria-Bertani agar plates supplemented with ampicillin (Sigma-Aldrich).
-
bioRxiv - Immunology 2021Quote: ... Plates were washed and developed with p-NitrophenylPhosphate (Sigma). 405nm absorbance was detected using a SPECTRAmax190 plate reader (Molecular Device).
-
bioRxiv - Immunology 2021Quote: ... enzyme-linked immunosorbent spot (ELISPOT) multiscreen filtration plates (Millipore) were activated with absolute ethanol ...
-
bioRxiv - Cell Biology 2020Quote: ... The plates were coated with 0.01% gelatin (Sigma-Aldrich) prior to seeding.
-
bioRxiv - Immunology 2019Quote: ... 96 well ELISPOT plates (Multi-Screen HA Filtration, Millipore) were coated overnight with anti-IgM (331 ...
-
bioRxiv - Neuroscience 2019Quote: ... The plate was sealed with AbsorbMax film (Sigma-Aldrich) and incubated at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... in Multiscreen PCR cleaning plates (Millipore, Burlington, Massachusetts, USA) with vacuum application (10 psi) ...
-
bioRxiv - Molecular Biology 2019Quote: ... plate 2 is treated with doxycycline (Sigma, D9891-25g) at a final concentration of 2 μg/ml 24 hours after duplication for visualization of EGFP+ colonies (with high levels of EGFP expression serving as a proxy for high dCas9 expression) ...
-
bioRxiv - Cell Biology 2019Quote: ... Lipid extracts were loaded onto a TLC plate (Millipore) along with egg and milk sphingomyelin as lipid standards ...
-
bioRxiv - Immunology 2019Quote: ... Plates were coated with 0.01% poly-L-Lysine (Sigma) for 5 min at room temperature and then dried for 30 min at 42°C ...
-
bioRxiv - Immunology 2019Quote: ... Plates were revealed by phosphatase alkaline substrate (Sigma-Aldrich), and absorbance was measured at 450 nm minus 540 nm ...
-
bioRxiv - Microbiology 2019Quote: ... Plates were covered with AeraSeal film (Sigma-Aldrich, #A9224) before incubation for 24 hours at 28 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... coated plates in DMEM high-glucose (Sigma-Aldrich, D5671) supplemented with 15% FBS (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... was added to plates followed by Streptavidin peroxidase (Sigma). Plates were developed with ABTS (10% 2,2’azino 3-thyl benzthiazoline ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed before adding Sigmafast BCIP/NBT (Sigma) substrate solution ...