Labshake search
Citations for Millipore Sigma :
1901 - 1950 of 10000+ citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... cells were incubated with 500 μM indole-3-acetic acid (IAA) (Sigma) for the indicated times.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice had unlimited access to water containing 1.5% - 3% citric acid (Sigma) in the standard home cage bottle ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mg/mL of poly[(R)-3-hydroxybutyric acid] (Sigma-Aldrich, USA) was used as a PHB standard ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% polyacrylamide gels supplemented with 0.33 % 3-acrylamidophenylboronic acid (APB; Sigma Aldrich); (ii ...
-
bioRxiv - Genetics 2024Quote: ... The natural auxin indole-3-acetic acid (IAA) was purchased from Sigma‒Aldrich (#12886) ...
-
bioRxiv - Microbiology 2024Quote: A solution of ILA (DL-Indole-3-lactic acid; Sigma; cat# I5508) in sterile 1X PBS was made by vortexing before and after a 10 min incubation at 56°C to fully dissolve ILA ...
-
bioRxiv - Bioengineering 2024Quote: ... 3 mg/mL hyaluronic acid sodium salt (HyA, 53747, Sigma-Aldrich, MO), and 0.25% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... 4 μL betaine (5 M, Sigma-Aldrich), 0.23 μL magnesium chloride (1 M ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4-AP (5 mM; Sigma-Aldrich) to isolate monosynaptic responses ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µM of 4-NQO (Sigma-Aldrich) was added to cell culture media for 4 hr before cell harvest.
-
bioRxiv - Microbiology 2023Quote: ... 5 ng/ml IL-4 (Sigma I1020), and 20 µg/ml LPS (Sigma L-2630) ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL 5 M Betaine (Sigma-Aldrich), 6.4 μL Water ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were mixed 1:1 with SB 4% (w/v) N-lauroyl-sarcosine (sarkosyl, Sigma), 2 U.μl-1 Benzonase (Novagen ...
-
bioRxiv - Bioengineering 2023Quote: Photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy) phenyl]-2-methyl-1-propanone (HEPK, Sigma Aldrich) was dissolved into deionized water to obtain an approximately 0.077 wt% solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... the samples were fixed in a 1:1 mixture of 4% para-formaldehyde (Sigma-Aldrich) and heptane (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... with or without 4 µM Liproxstatin-1 (Lip-1) (SML1414, Sigma Aldrich, St. Louis, USA) with or without 20 µM Q-VD-Oph hydrate (QVD ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Bioengineering 2021Quote: ... scaffolds were rehydrated in PBS overnight with 1-ethyl-3-(3- dimethylaminopropyl) carbodiimide (EDAC, Sigma-Aldrich) and N- hydroxysuccinimide (NHS ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA was fixed by using 1-ethyl-3-[3- dimethylaminopropyl] carbodiimide hydrochloride (EDC, Sigma-Aldrich) for 1 h at 60°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti- Spz (rat, 1:50, requested from Satoshi Goto), Anti-Elav (rabbit, 1:50, DSHB) and Caspase 3 (rabbit, 1:500, Sigma Aldrich). Samples were washed four times for 10 minutes each in PBST and incubated at room temperature in secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... a mouse monoclonal anti-chondroitin sulfate antibody (clone CS-56, 1:500 for Experiment 1 and 3 or 1:1000 for Experiment 2, C8035, Sigma Aldrich) specific for the glycosaminoglycan portion of the chondroitin sulfate proteoglycans that are the main components of the PNN and a polyclonal rabbit anti-parvalbumin antibody (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 µM 5-Fluoro-20-deoxyuridine (FDU) and 4 µM Uridine (Sigma). On day 8 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4 mM 4-Nitrophenyl acetate (Sigma-Aldrich; Cas: 830-03-5) in a buffer containing 100 mM NaCl and 50 mM sodium phosphate ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Chemical compounds were first identified using the NIST library and later confirmed with co-elution of synthetic 4-methyl-3-heptanone (Pfaltz and Bauer M19160) and 4-methyl-3-heptanol (Sigma Aldrich M48309). Compounds eluting after 30 minutes were excluded from the analysis due to lack of volatility.
-
bioRxiv - Biochemistry 2020Quote: ... The full-length MtaLonA were prepared by supplementing the growing medium with 1 g l−1 of 15NH4Cl and 4 g l−1 of 2H7/12C6-glucose in 99.8%-2H2O (Sigma-Aldrich).
-
bioRxiv - Microbiology 2024Quote: ... strains were streaked from cryostocks on LB agar (10 g L-1 tryptone, CRITERION™, 5 g L-1 yeast extract, Sigma-Aldrich and 5 g L-1 NaCl) and incubated for 2 days at 30 °C ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were incubated with primary antibodies overnight at 4°C (rabbit anti-PALS-5 diluted 1:1,000 and mouse anti-tubulin (Sigma, catalog number T9026) diluted 1:3000 in blocking buffer) ...
-
bioRxiv - Bioengineering 2021Quote: ... The gel compartment was removed after 1 to 5 days of incubation (depending on fusion) by adding 4 w/v% sodium citrate (Sigma Aldrich Inc.) for 15 min as a lyase for alginate (Supplementary figure 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then incubated with the primary antibodies in a blocking solution for 5 days at 4°C: mouse anti-GFAP (G3893, Sigma, 1:300), mouse anti-HSP70 (MA3-028 ...
-
bioRxiv - Biophysics 2020Quote: ... 20 µL of 10 % Tween® 20 and 20 µL of a potassium phosphate buffer (4:5 mixture of 1 M monobasic and dibasic potassium phosphate, Sigma Aldrich, USA) were added as well as 10 µL of a 2 nmol thiol-modified single-stranded DNA solution (5’-T20-SH-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... HCECs were grown in a hypoxia chamber with 2% O2 and 5% CO2 at 37°C in 4 parts DMEM to 1 part medium 199 (Sigma-Aldrich #M4530) with 2% cosmic calf serum (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... and proteins were eluted with 4 mL of the same buffer but containing 100 μL (5 mg mL−1) Flag peptide (Sigma-Aldrich F4799). The eluate was spin concentrated (Sigma-Aldrich CLS431485-251A ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were permeabilized for 10 minutes in 0.5% Triton X in PBS and incubated for 48 hours at 4°C in rabbit anti-NG2 (AB5320, Merck Millipore; 1:500) and rat anti-MBP (MCA409 ...
-
bioRxiv - Neuroscience 2024Quote: ... and probed with the following antibodies (diluted in 5% milk in PBST) overnight at 4 °C: α-Tubulin (1:400000, Sigma t9026), α-Dnmt3a (1:5000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were recovered from Matrigel using 3 mM EDTA in DPBS, washed, centrifuged (200g, 5 min, 4°C) and lysed with 1x RIPA buffer supplemented with PPI (1:100, Sigma- Aldrich, 04693132001), and benzonase (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... then in the anti-dopamine receptor antibody diluted in the blocking solution for 5-6 days at 4°C (rabbit anti-dopamine D1A receptor, 1:100, Sigma-Aldrich AB1765P). Sections were washed in PBS and incubated for 2 h at RT in the secondary antibody (goat anti-rabbit Alexa Fluor 555) ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Cell Biology 2022Quote: ... The tissue sections where fixed in -20 °C methanol for ten minutes followed by a blocking cycle (5×3 min) using phosphate buffered saline containing 1% bovine serum albumin (Sigma-Aldrich, Copenhagen, Denmark). The samples where then incubated overnight at 4 °C with the primary antibodies (dilution factor ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with 0.05% Tween-20 in phosphate buffered saline (PBST) for 3 × 5 min with agitation and incubated with anti-β actin (1:1000 rabbit polyclonal (Sigma Aldrich; A2066) or 1:5000 mouse monoclonal (Sigma Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... The aorta was dissected circumferentially away from the surrounding tissues and subjected to 3 minutes of either 5 µL of peri-adventitial elastase (0.4 U/mL type 1 porcine pancreatic elastase, Sigma Aldrich, St. Louis, MO) or heat-inactivated elastase as control ...
-
bioRxiv - Plant Biology 2021Quote: ... The samples were prepared in 1:1 mixture of H2O-ACN with 0.1% TFA by mixing an equal amount of peptide fractions (0.5 μl) with α-cyano-4-hydroxycinnamic acid (CCA)/2,5-dihydroxy benzoic acid (DHB) matrix (Sigma) and spotted on a stainless-steel plate and air-dried ...
-
bioRxiv - Bioengineering 2021Quote: ... and (3) 4- methylmorpholine (4.5 equiv:ELP amine; Sigma, M56557). The reagents are dissolved at room temperature (RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... CHIR99021 [3 µM] and 4.5x10-4 M Monothioglycerol (Sigma). On day 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% FBS and 1% non-essential amino acids (M7145, Sigma Aldrich) in the same conditions mentioned above ...