Labshake search
Citations for Millipore Sigma :
1851 - 1900 of 10000+ citations for Methacrylic acid N hydroxysuccinimide ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Immunology 2022Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37°C overnight with 600 rpm shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were incubated for 4 hours at 22 °C in 0.5 mM N-nitroso-N-ethylurea (ENU, Sigma Aldrich N3385), washed thoroughly in M9 buffer (22 mM KH2HPO4 ...
-
bioRxiv - Neuroscience 2024Quote: ... The antibodies used were GluA1-N (NeuroMab, SKU: 75-327, 1:100) and GluA2-N (Millipore, Cat# MAB397, 1:100). For standard labeling ...
-
bioRxiv - Immunology 2024Quote: ... 50 mM of iodoacetamide (BioUltra, Millipore Sigma #I1149) (1 M stock in anhydrous N, N-Dimethylformamide (DMF (Millipore Sigma #227056)) ...
-
bioRxiv - Cell Biology 2024Quote: ... gels were incubated in a third gelling solution (19% SA, 10% AAm, 0.1% N,N′-methylenebis(acrylamide) (BIS; Sigma, 14602), 0.05% APS and 0.05% TEMED ...
-
bioRxiv - Cell Biology 2024Quote: ... then incubated in a MES buffer solution containing 50 mg/ml N(3Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC, Sigma Aldrich, E7750) and 50 mg/ml NHydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2021Quote: ... n-octylglucoside (OG, Sigma-Aldrich, St. Louis, MO), 3-((3-cholamidopropyl ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM N-Acetyl-L-cysteine (Sigma Aldrich) and 10 mM Heregulin Beta-1 (PeproTech).
-
bioRxiv - Cell Biology 2020Quote: N-Acetyl-L-cysteine (cat# A7250, Sigma-Aldrich)
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM N-Acetyl-L-cysteine (Sigma-Aldrich). 10 μM Y-27632 was added for the first two days of culture ...
-
bioRxiv - Immunology 2021Quote: ... 0.5% n-Octyl-β-D-glucopyranoside (Merck Millipore). Finally lysates were subjected to chromatin shearing with Qsonica Sonicator Q700 (Thermoscientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and N-Acetyl-L-cysteine (NAC, Sigma, A7250) enriched diets were prepared by supplementing regular fly food with weight/volume measures of succinate and NAC to achieve 3% and 0.1% concentrations ...
-
bioRxiv - Immunology 2022Quote: ... 1.25 mM N-Acetyl-L-cysteine (Sigma, A9165), 500 nM A83-01 (Tocris ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.65 g N-hydroxysulfosuccinimide (NHS, Sigma-Aldrich), which was then mixed with another 200 mL ethanol (80% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4 mM N-ethylmaleimide (Sigma Cat. E3876) and 4 mM 1,10-phenanthroline (Sigma Cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM N-Acetyl-L-cysteine (Cysteine; Sigma), 10 mM Zinc sulfate heptahydrate (Zinc ...
-
bioRxiv - Neuroscience 2020Quote: Clozapine-N-oxide (CNO) (Sigma: C0832, Tocris: 4936) prepared in saline was intraperitoneally injected (12 μg/g body weight)64 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-Acetylcystine (Sigma Aldrich A9165-5G), 100 μg/ml Primocin (Invivogen ant-pm-1) ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 mM N-acetyl L-Cysteine (Sigma #A9165), and 55 µM 2-mercaptoethanol (Sigma #M3148-100ML ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-acetyl-L-cysteine (Sigma-Aldrich) in basal culture medium ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2% N-21 (Cat #SCM081, Millipore Sigma), plated at a density of 5 ganglia per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... and N-Ethylamaleimide (Sigma-Aldrich, St. Louis, MO). The concentration of all proteins was measured using Bio-Rad’s Bradford dye following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM N-acetyl-L-cysteine (Sigma Aldrich), 100 ng/mL recombinant murine EGF (PeproTech) ...
-
bioRxiv - Bioengineering 2021Quote: ... Monomers N-(3-methoxypropyl)acrylamide (MPAM; Sigma, 95%), 4-acryloylmorpholine (MORPH ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... N-Methyl-4-phenylpyridinium Iodide (MPP+, Sigma-Aldrich) 10 mM in water ...
-
bioRxiv - Cell Biology 2021Quote: ... N-ethylmaleimide and DTT were obtained from Sigma. Tris(2-carboxyethyl ...
-
bioRxiv - Cell Biology 2021Quote: ... N-Acetyl-L-cysteine (1,25 mM, Sigma #A9165), Nicotinamide (5 mM ...
-
bioRxiv - Microbiology 2020Quote: ... n-Dodecyl β-D-maltoside (DDM, D4641, Sigma), at a final concentration of 0.1% was used to lyse the virus.
-
bioRxiv - Microbiology 2020Quote: ... 20 μM N-acetyl cysteine (Nac, Sigma-Aldrich) was added ...
-
bioRxiv - Microbiology 2020Quote: ... N-acetyl-glucosamine (NAG, Sigma, Cat. No. A3286) was added to the culture to a final concentration of 50 mM from day 6 to day 11 of the culture ...
-
bioRxiv - Bioengineering 2021Quote: ... and N-methyl-2-pyrrolidone (NMP, Sigma-Aldrich) at a 1:1 volume ratio was used with the pneumatic atomiser and a tip size of 300 μm ...
-
bioRxiv - Cell Biology 2021Quote: ... Sigma) in 40% N-methylacetamide (Sigma-Aldrich #M26305) in PBS ...
-
bioRxiv - Biophysics 2020Quote: ... NEM (N-Ethylmaleimide, Sigma-Aldrich, St. Louis, MO); DTT (dithiothreitol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... BIO 14μM (cat n° B1686, Sigma-Aldrich Merck) and SB505124 30μM (cat n° S4696 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... BIO 1μM (cat n° B1686, Sigma-Aldrich Merck) and SB505124 50μM (cat n° S4696 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... SU5402 20μM (cat n° SML0444, Sigma-Aldrich Merck), BIO 14μM (cat n° B1686 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1.25 mM N-acetylcysteine (Sigma-Aldrich #A9165-5G), 50 ng/mL EGF (Invitrogen #PMG8043) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 3% tri-n-octylphosphineoxide (Sigma-Aldrich, USA) was recirculated at a flow rate of 20 mL min− 1 between the forward and backward contactors ...
-
bioRxiv - Bioengineering 2022Quote: ... 1.25 mM n-acetyl cysteine (A5099; Sigma-Aldrich), recombinant murine epidermal growth factor (50 ng/mL-1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... N-acetylcysteine (2 mM) (Sigma, Cat#A9165-25G), Nicotinamide (20 mM ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-polyQ 1:1,000 (Sigma, Cat. n° P1874), anti-HSP90 1:2,000 (Santa Cruz ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM N-acetyl-cysteine (NAC, Sigma A7250) was added to all wells where appropriate ...
-
bioRxiv - Neuroscience 2021Quote: ... or BSCO (Scopolamine N-butyl bromide, Sigma Aldrich) as pretreatment 1 hour before the start of the MRI measurement ...
-
bioRxiv - Cell Biology 2020Quote: ... Two Lpd-specific antibodies were purchased from Sigma (HPA016744 recognising the N-terminus, Sigma-Aldrich, Germany) and Santa Cruz Biotechnology (European Support ...
-
bioRxiv - Physiology 2021Quote: ... and 7.5% N-phenylthiourea (Sigma-Aldrich, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2020Quote: ... and 1 mM N-acetyl cysteine (Sigma-Aldrich). Cells were passed through 0.4 micron cell strainer (Falcon) ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-acetyl-L-cysteine 1□μM (Sigma-Aldrich), N2 1X (Life Technologies) ...