Labshake search
Citations for Millipore Sigma :
1801 - 1850 of 10000+ citations for Integrin alpha 5 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 1:500), Rabbit anti-phospho Chk1 (CST, 1:200), Rabbit anti-phospho Smad (CST, 1:150) Rabbit anti-pH3 (Millipore, 1:500), and Alexa 488/568/647-conjugated Donkey anti-Chicken/Rabbit/Mouse secondary antibodies (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... antigen retrieval and antibody staining (anti-PER2, Alpha Diagnostic, cat. PER21-A, 1:200 dilution; anti-GFAP, Abcam, cat. ab53554, 1:500 dilution; anti-NeuN, Merck Millipore, cat. mab377, 1:250 dilution). The procedures have been described by our laboratory in detail elsewhere (Brenna et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The obtained antisera were affinity-purified with recombinant Emi2-His protein electroblotted onto a membrane (Immobilon; EMD Millipore).
-
bioRxiv - Biochemistry 2019Quote: 25 µl of 100 µM recombinant purified GST Pat1-NC was bound to 30 µl GST-slurry (Sigma), and one aliquot of GST-beads was included without added Pat1-NC as negative control ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with cytokine cocktails aimed at proliferation (50 ng/ml murine recombinant thrombopoietin (TPO, Sigma-Aldrich SRP3236-10UG) and 100ng/ml Stem Cell Factor (SCF) ...
-
bioRxiv - Immunology 2019Quote: ... NMRI mice were injected subcutaneously at two different locations with 100µg of the recombinant Thio-EmACT resuspended in 100µl Freund Incomplete adjuvant (Sigma). The double injections were repeated four weeks later to boost the mice anti-EmACT response ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then isolated from the supernatant by nickel affinity chromatography using loose Ni-NTA resin (Sigma). Protein eluted from Ni-NTA resin was filtered and then loaded onto a size exclusion column (Superdex 75 16/60 ...
-
bioRxiv - Cell Biology 2021Quote: ... FAK) recombinant proteins to be labeled with Alexa fluorophores were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) to ∼100 μM ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant FLAG-tagged zebrafish Grk1a and Grk1b were each inserted into the pFLAG-CMV2 vector (#E7033, Millipore-Sigma). HEK-293 cells cultured in DME/F-12 with 10% fetal bovine serum were transfected with either of these constructs using FuGENE 6 Transfection Reagent (#E2691 ...
-
bioRxiv - Bioengineering 2022Quote: ... Epidermal growth factor (EGF) and Recombinant Human Fibroblast Growth Factor Basic (FGF2) Progesterone were purchased from Sigma-Aldrich. OPSS-PEG-SVA (3400 Da) ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant FLAG-tagged zebrafish Grk1a and Grk1b were each inserted into the pFLAG-CMV2 vector (#E7033, Millipore-Sigma). HEK-293 cells cultured in DME/F-12 with 10% fetal bovine serum were transfected with either of these constructs using FuGENE 6 Transfection Reagent (#E2691 ...
-
bioRxiv - Biochemistry 2019Quote: ... The pure recombinant protein was eluted from the column using the same buffer with 0.1 mg.mL-1 FLAG peptide (Sigma). Pure PRMT7 was flash frozen and stored at −80 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentration of total protein in CFE with recombinant Scaf19LKT was determined by Bradford reagent (Sigma-Aldrich, USA), CFE was diluted 1,000-times in 0.1 M sodium carbonate coating buffer (pH 9.0) ...
-
bioRxiv - Zoology 2020Quote: ... recombinant RhATG5 and RhATG5191-199Δ were affinity-purified using Ni-NTA His•Bind Resin (Merck-Millipore, Darmstadt, Germany). Recombinant RhATG5 and RhATG5191-199Δ were then incubated with 10µg μ-calpain (Merck ...
-
bioRxiv - Immunology 2020Quote: ... Transduced CD8+ T cells were expanded in the presence of 10 U/ml recombinant human IL-2 (Sigma) Human CD8+ T cells were purified from donor PBMCs (Cambridge Bioscience or NHSBT ...
-
bioRxiv - Cell Biology 2020Quote: ... the cell medium was replaced with DMEM containing 0.2% FBS and 300ng/mL IGF-1 (human recombinant, Sigma) for 3 hours ...
-
bioRxiv - Immunology 2020Quote: ... were coated overnight at 4°C with 2.5μg/ml of recombinant RBD protein in carbonate-bicarbonate coating buffer (Sigma). After blocking with PBS containing 1% BSA ...
-
bioRxiv - Biochemistry 2022Quote: ... and ∼1 μg recombinant GST or GST-SMN in freshly made 25 mM bis tris propane (Sigma B6755) pH 6.8 buffer with 1 M NaCl and 0.05% NP-40 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells that were cultured in 0.5 % FBS were stimulated with hEGF (recombinant EGF) (Sigma Alrdich, Catalog No: E9644) in concentrations (10 and 30 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... except for the control group for which recombinant fusion proteins were mixed with incomplete Freund adjuvant (IFA, Sigma). Blood samples were collected from the submandibular vein at different time points for more than 6 months and sera were prepared and analysed for the presence of specific antibodies by ELISA as described below ...
-
bioRxiv - Immunology 2022Quote: ... a control group received injection of recombinant fusion proteins (3.8 μM) mixed with complete Freund adjuvant (CFA, Sigma) in 50 μl of PBS ...
-
bioRxiv - Microbiology 2022Quote: ... Assay was conducted according to the manufacturer’s instructions and recombinant L-Lactic Dehydrogenase from porcine heart (Sigma-Aldrich) was used to generate a standard curve ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.1 IU/mL insulin and 10 ng/mL human recombinant epidermal growth factor (EGF) (all from Sigma-Aldrich). TKCC10 cells were grown in a 1:1 mixture of M199 medium and Ham’s F12 medium ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were incubated with medium containing 10 µg/mL recombinant human adiponectin (SRP4901, Sigma-Aldrich, in sterile water), a quantity equivalent to typical adiponectin levels in lean women (Ding et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The recombinant proteins were purified using a Ni-NTA column (Yeasen, Wuhan, China) and concentrated by ultrafiltration (Millipore). Protein concentration was determined by SDS-PAGE using BSA as a standard.
-
bioRxiv - Bioengineering 2023Quote: ... mESC maintenance media was supplemented with 1,000 units/mL of Recombinant Mouse Leukemia Inhibitory Factor (Millipore Sigma # ESG1107). Media was changed daily.
-
bioRxiv - Immunology 2023Quote: RVT1 association with the recombinant form of human PF4 and UPS-grade protamine (Millipore-Sigma, St. Louis, MO) were characterized using a Synapt G2 HDMS (Waters Corp. ...
-
bioRxiv - Immunology 2023Quote: RVT1 association with the recombinant form of human PF4 and UPS-grade protamine (Millipore-Sigma, St. Louis, MO) were characterized using a Synapt G2 HDMS (Waters Corp. ...
-
bioRxiv - Cell Biology 2023Quote: 2 μg GST-tagged NuSAP point mutants were incubated with 50 ng human recombinant Aurora A (Sigma-Aldrich) in a water bath at 30°C for 30 min in kinase buffer (50 mM Tris-HCl ...
-
bioRxiv - Immunology 2022Quote: ... CD8+ T cells were expanded in the presence of 10 U/mL recombinant human IL-2 (11147528001, Sigma). Human CD8+ T cells were purified from donor PBMCs (NHSBT or Karolinska Hospital ...
-
bioRxiv - Cell Biology 2023Quote: ... either coated with BSA or recombinant Laminin332 (BioLamina LN332-0502, diluted in Dulbecco’s Phosphate Buffered Saline, Sigma, D8662) and left to adhere overnight ...
-
bioRxiv - Biochemistry 2023Quote: His-PP-Pex6 1-204 protein (purified by recombinant expression from plasmid pDC69) was digested with 0.1 or 0.2 μg/μL trypsin protease (Sigma) for 10 minutes at 23 °C in 100 mM Tris pH 8.0 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... and the recombinant protein was eluted using buffer D supplemented with 10 mM reduced L-glutathione (Sigma–Aldrich). The purified protein was digested with TEV protease overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... 250-500 μg of recombinant proteins were resuspended in HAT buffer supplemented with 0.75 mM acetyl CoA (Sigma) and 1 μl butyric acid (200 mM ...
-
bioRxiv - Genetics 2020Quote: ... incubated for 3 hours at 25 °C with the secondary antibody (anti-rabbit IgG peroxidase 1:10000, Sigma-Aldrich; anti-mouse IgG peroxidase 1:10000, Sigma-Aldrich; in 5% milk, 1xTBS,0,1% Tween) and washed 3 times with 1xTBS/0.1% Tween ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated at room temperature with secondary antibodies coupled to horseradish peroxidase (1:20,000 Thermo Fisher goat-anti-rabbit, or 1:20,000 Millipore Sigma goat-anti-rat in 5% nonfat dry milk). Membranes were washed again in PBS containing 0.1% Tween 4 x 15 min ...
-
bioRxiv - Immunology 2022Quote: ... of anti-S murine antibodies (including cross-reactive mAbs to SARS-CoV) and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Microbiology 2022Quote: ... and −7173 of anti-S murine antibodies (including cross-reactive mAbs to SARS-CoV) and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Microbiology 2022Quote: ... of anti-S murine antibodies (including cross-reactive mAbs to SARS-CoV) and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Microbiology 2023Quote: ... of anti-spike murine antibodies (including cross-reactive mAbs against SARS-CoV) and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Microbiology 2023Quote: ... and -71)60 of anti-S murine antibodies (including cross-reactive mAbs to SARS-CoV) and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Neuroscience 2023Quote: ... we added both the XPoSE-tag and neuronal nuclear marker NeuN (anti-NeuN Mouse mAb clone A60, MAB377X, Millipore Sigma, RRID: AB_2149209, 1:500) We incubated the samples with antibody for 15 minutes at 4 °C on a rotating mixer ...
-
bioRxiv - Microbiology 2024Quote: ... and -71 60 of anti-spike murine antibodies (including cross-reactive mAbs to SARS-CoV) and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924, RRID: AB_258426) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Bioengineering 2024Quote: ... Washes were followed by the addition of 100 μL of anti-FLAG horseradish peroxidase (HRP)-linked monoclonal antibody (mAb, #A8592, Sigma Aldrich, St. Louis, MO) for 1 h at room temperature with rocking ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...