Labshake search
Citations for Millipore Sigma :
1801 - 1850 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and 1 mg/mL Collagenase Type IV (Sigma C5138). Digested spleens were then mashed through a 70 μm cell strainer and washed with 15 mL PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 125 U/mL collagenase type XI (C9407; Sigma-Aldrich), 60 U/mL DNase I (18047019 ...
-
bioRxiv - Bioengineering 2024Quote: ... fibrinogen Type 1-S (20 mg/mL, Sigma, MO) was dissolved in PBS and incubated at 37 °C for 45 min ...
-
bioRxiv - Genetics 2024Quote: ... and Collagenase Type P (0.4 mg/mL, Merck Millipore) in Leibovitz’s L-15 Medium (Gibco) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and protease (type XIV, Sigma Chemical Co. London, UK)[32 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human haemoglobin (Sigma) was used for creation of standard curve.
-
bioRxiv - Microbiology 2021Quote: ... human insulin (Sigma), 10’000 units/ml of penicillin and 10’000 µg/ml streptomycin (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... human HDL (Millipore), human LDLs (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... human LDLs (Millipore) or an in vitro reconstituted NS1-HDL mix were analyzed by size exclusion chromatography on a Superdex 200 10/300 column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human hemoglobin (Sigma) was dissolved in PBS to 10 mg/mL or 1 mg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... Human DPP4 (Sigma) was used as a control in PBS at 50 ng/μL (0.585 μM) ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated from overnight cultures of the wild type and mutant strains using GenElute Bacterial Genomic DNA Kits (Sigma-Aldrich, USA). Library preparation and whole genome sequencing were performed by Glasgow Polyomics ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated with antibodies against selected proteins overnight at 4°C: Anti-β-Tubulin III (β-Tub III) (Sigma, T8660, mouse, 1:2000); anti-p-Tau (Cell Signaling ...
-
bioRxiv - Genomics 2021Quote: DNA from human keratinocyte cells was extracted using the “GenElute-Mammalian Genomic DNA Miniprep Kit” (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Insulin concentrations after the 16 h hyperinsulinemia treatment were determined using human insulin RIA kit (Millipore). To mimic starvation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Recombinant human EGF (Cat# E9644) and Glucose Quantification Kit (Cat# GAGO-20) purchased from Sigma-Aldrich; Cisplatin (Cat# 232120 ...
-
bioRxiv - Biophysics 2020Quote: ... were added to 1 mL of 10 mg∙mL−1 of N-(3-dimethylaminopropyl)-N’-ethylcabodiimidie hydrochloride (EDC, Sigma-Aldrich) dissolved in 100 mM sodium phosphate ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were dissolved in 50 μL of 20 mg/ml methoxyamine hydrochloride in pyridine for 1.5 h at 33°C followed by derivatization with N-Methyl-N-(trymethylsolyl)trifluoroacetamide (MSTFA, Sigma Aldrich) for 2 h at 35°C.
-
bioRxiv - Microbiology 2021Quote: ... 4 mg of Arixtra was added to 10 volumes (w/w) of N-Methy-N-(trimethylsilyl)-trifluoroacetamide (MTSTFA, Sigma, ≥98.5%) and 100 volumes (v/w ...
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... and incubated at 37° C for 90 minutes followed by addition of 20μL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated at 37°C for 90 minutes followed by addition of 20µL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert– Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Plant Biology 2020Quote: ... The combined organic phase was dried using CentriVap Cold Traps (Labconco) and derivatized using bis-(N,N,-trimethylsilyl)-tri-fluoroacetamide (BSTFA; Sigma) as described previously (Franke et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Terminal cellular differentiation was induced with 10 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT; Sigma-Aldrich) while mucus-secretion was enhanced with 10 nM phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Cell Biology 2021Quote: SK-N-SH-N cells were plated onto 6-well tissue culture plates coated with poly-L-lysine (Sigma-Aldrich). Cells were plated at 3×105 cells/ml in MEMα medium containing a very low-serum level (2% FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 1h at 37°C and then with 20μL 1% tert-butyldimethylchlorosilane in N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma Aldrich) for 3h at 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... in pyridine at 70°C for 15 min followed by addition of N-tert-Butyldimethylsiyl-N-methyltrifluoroacetamide (MTBSTFA, Sigma-Aldrich) for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... The sample was then derivatized by adding 60 μL N-methyl-N-(trimethylsilyl)trifluoro acetamide (MSTFA) (Cat# 69479; Sigma-Aldrich) and incubating for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gelatin was subsequently cross-linked using N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC hydrochloride) (Sigma Aldrich Catalog No-03450) and N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Genomics 2021Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37 degrees overnight with 600 rpm shaking ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated for 16 hours with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-phenylglycin T-butyl ester (DAPT) (Sigma Aldrich), an inhibitor of γ-secretase ...
-
bioRxiv - Neuroscience 2021Quote: ... received bilateral infusions of either vehicle (aCSF; pH 7.4; males n = 5; females n = 4) or the GABAA receptor agonist muscimol (Sigma Aldrich, M1523 ...
-
bioRxiv - Microbiology 2022Quote: ... The dried remainder of eluate 2 was dissolved in 50 µl dry acetonitrile and 50 µl N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide containing 1% tert-butyldimethylsilyl chloride (Sigma) and kept at 70°C for 30 min ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... To the bead suspension was added 0.5 mL of 750 mM of N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) in water (Sigma-Aldrich) and the mixture was incubated for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... animals were injected with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (Sigma, Cat no. D5942) (10 mg/kg/day ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The ML321 was dissolved in a small amount of N,N-dimethylacetamide (DMA) with previously heated Tween-80 (Sigma-Aldrich) and vortexed until the solution was solubilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... we prepared NGM dishes as above and added paraquat (N,N’-dimethyl-4,4’-bipyridium dichloride, 36541, Sigma-Aldrich, Burlington MA) to the molten agar to a final concentration of 40 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult female SNSiDTR (n=6) and TrkBiDTR (n=19) mice were injected i.p with 40 μg/kg DTX (Sigma, D0564) with a second dose after 72 h ...
-
bioRxiv - Immunology 2023Quote: ... were added followed by dropwise addition of 500 µl 2X BES (50 mM N,N-bis(2hydroxyethyl)-2-aminoethanesulfonic acid (Sigma) + 280 mM NaCl (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with the noradrenergic neuron specific neurotoxin N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP4; Sigma, C8417) once at a dose of 50 mg/kg (i.p.) ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Immunology 2022Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37°C overnight with 600 rpm shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were incubated for 4 hours at 22 °C in 0.5 mM N-nitroso-N-ethylurea (ENU, Sigma Aldrich N3385), washed thoroughly in M9 buffer (22 mM KH2HPO4 ...
-
bioRxiv - Neuroscience 2024Quote: ... The antibodies used were GluA1-N (NeuroMab, SKU: 75-327, 1:100) and GluA2-N (Millipore, Cat# MAB397, 1:100). For standard labeling ...
-
bioRxiv - Microbiology 2024Quote: ... Other carbon sources (acetate, glucose, glucosamine, N-acetyl-D-glucosamine, galactose, N-acetyl-D-galactosamine, fucose, mannose, and sialic acid; Sigma) were added to M9 minimal medium at a concentration of 10 mM.
-
bioRxiv - Immunology 2024Quote: ... 50 mM of iodoacetamide (BioUltra, Millipore Sigma #I1149) (1 M stock in anhydrous N, N-Dimethylformamide (DMF (Millipore Sigma #227056)) ...
-
bioRxiv - Cell Biology 2024Quote: ... gels were incubated in a third gelling solution (19% SA, 10% AAm, 0.1% N,N′-methylenebis(acrylamide) (BIS; Sigma, 14602), 0.05% APS and 0.05% TEMED ...