Labshake search
Citations for Millipore Sigma :
1801 - 1850 of 10000+ citations for Dengue Virus Serotype 3 DIII envelope protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2024Quote: ... The amine reactive second-generation (AR2G) biosensors were processed with 1-ehtyl-3-(3-dimethylaminopropy) carbodiimide hydrochloride (EDC, E1769, Sigma) and sulfo-N-hydroxysulfosuccinimide (s-NHS ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mm ID × 150 mm, 3-μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate / water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Dried extracts were phase-separated using -20°C LCMS-grade chloroform/methanol/water (1:3:3, v/v) (Sigma Aldrich).
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Neuroscience 2023Quote: ... were placed in the middle of a 2% agar plate containing a container with 10 µl n-amylacetate (AM, diluted 1:50 in mineral oil; SAFC) or 3-Octanol (3-Oct, Sigma) on one side and a blank on the other side ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Plant Biology 2024Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H screen/ assay ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice received daily intraperitoneal injections of L3,4-dihydroxyphenylalanine methyl (L-DOPA or levodopa, 3 days at 3 mg/kg and then 6 mg/kg, Sigma-Aldrich) and benserazide hydrochloride (12 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: 4-week-old TRE-Arhgef11/Krt14-rtTA mice (3 males and 3 females) were IP-injected with 25 mg/kg doxycycline (Sigma) 10 hours before sacrifice and tissue collection.
-
bioRxiv - Cell Biology 2024Quote: ... 3×flag-N-WASP or 3×flag-WIP2 C2C12 cells were immunostained with mouse anti-Flag (1:200; Sigma; F1804), rabbit anti-WAVE2 (1:200 ...
-
bioRxiv - Biochemistry 2024Quote: The DNA used in the crystallization of the NtcA-2OG-DNA complex was prepared by 10-min heating at 65°C of an equimolar mixture of the synthetic oligodesoxyribonucleotides 5’-AGCTGATACATAAAAAT-3’ and 5’-CATTTTTATGTATC-3’ (from Sigma) in 5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2024Quote: ... MICAL1#2 (5′CUCGGUGCUAAGAAGUUCU[dU][dU]3′) (75) and Rab35 (5′GCUCACGAAGAACAGUAAA[dU][dU]3′) (76) were synthetized by Sigma.
-
bioRxiv - Cell Biology 2024Quote: ... the supernatants described above were diluted 10-fold with 0.1% formic acid and separated on a Discovery HS-F5-3 column (150 × 2.1 mm, 3 μm particle size; Sigma- Aldrich) with mobile phases consisting of solvent A (0.1% formic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... two siRNA sequences targeting different regions of NOK were designed as #1: 5’-GCAAGAAACAUUCAUGCAU-3’ and #2: 5’-GUCUUUCCCAGGGACACAA-3’ (SASI_Hs01_00043410 and SASI_Hs02_00351937, Sigma, St. Louis, MO, USA). The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... and phosphatase inhibitor cocktail 3 (Sigma-Aldrich; P0044). After centrifugation at 13,000 rpm for 10 minutes to remove cell debris ...
-
bioRxiv - Cell Biology 2020Quote: ... of 100µM glyceraldehyde 3-phosphate (G3P, Sigma-Aldrich) for 30 min on poly-HEMA-coated plates at 37 degrees C ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors (Sigma cocktail 3, 1:100 dilution) and 100 nM okadaic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked in 3% H2O2 (Sigma Aldrich) for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 3-isobutyl-1-methylxanthine (IBMX; Sigma) to inhibit phosphodiesterase cAMP degradation ...
-
bioRxiv - Cell Biology 2020Quote: ... [3-actin (Sigma Aldrich, A544l, dilution 1:10000), Oct 3/4 (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Indole-3-acetic acid (IAA, auxin) (I5148; Sigma) was dissolved in ddH2O and used at a final concentration of 500 μM ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1X Phosphatase Inhibitor Cocktail 3 (Sigma Aldrich). Cultured neurons were rinsed with ice-cold PBS and removed from coverslips in ice-cold RIPA buffer with a cell scraper ...
-
bioRxiv - Developmental Biology 2021Quote: ... then stained with hemotoxylin (Sigma GHS-3-32) and eosin (Sigma HT110-2-3 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.5% 3-(N,N-Dimethylmyristylammonio)propanesulfonate (Sigma T7763), 200 μg/mL RNase A ...
-
Phenotypic and molecular evolution across 10,000 generations in laboratory budding yeast populationsbioRxiv - Evolutionary Biology 2020Quote: ... 0.5% 3-(N,N-Dimethylmyristylammonio)-propanesulfonate (Sigma, T7763), 200µg/mL RNAse A ...
-
bioRxiv - Developmental Biology 2020Quote: ... sections were incubated in 3% hydrogen peroxide (Sigma) solution for 15 minutes.
-
bioRxiv - Physiology 2022Quote: ... and cycloheximide (chx, 3 mg/mL; Sigma-Aldrich) were used to induce elevated apoptosis and permeability.[29] The cells were grown for 5 days before incubation with TNF-α and chx (TNF-α/chx ...
-
bioRxiv - Neuroscience 2022Quote: ... CNO (3 mg/kg, i.p., C0832, Sigma-Aldrich) (33 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 3: Nε-acetyl-L-lysine (AcK, Sigma-Aldrich); 4 ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked 10 minutes with 3 % BSA (Sigma Aldrich) in PBS containing 0.05 % Tween-20 (PBST-0.05%) ...
-
bioRxiv - Molecular Biology 2021Quote: ... (R)-(-)-3-hydroxybutyric acid sodium salt (Sigma 298360) was added to the culture media at the indicated concentrations ...