Labshake search
Citations for Millipore Sigma :
1801 - 1850 of 10000+ citations for Dectin 1 CLEC7A Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Secondary anti-IgM human HRP conjugated antibody (Sigma-Aldrich) or anti-IgG human HRP (Jackson ImmunoResearch ...
-
bioRxiv - Genetics 2023Quote: ... 10 μg/ml recombinant human insulin (Sigma, 19278-5ML), 2 IU/ml heparin (Sigma ...
-
bioRxiv - Microbiology 2023Quote: - lactoferrin (Lactoferrin human, Sigma-Aldrich, USA, cat. no. L4040) 2 mg/mL solution in Dulbecco’s Phosphate Buffered Saline (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and anti-human CD28 antibody (5μg/ml) (#MABF408, Millipore). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.25 mg/ml human plasma fibronectin (Sigma-Aldrich, 341635), 0.25 mg/ml unlabelled vitronectin (PeproTech ...
-
bioRxiv - Cell Biology 2023Quote: ... human recombinant insulin at 0.01 mg/mL (Sigma, I9278), and 1% penicillin-streptomycin mix ...
-
bioRxiv - Immunology 2023Quote: ... depleted human serum lacking IgA/IgG/IgM (Sigma-Aldrich) was used as a negative control.
-
bioRxiv - Genetics 2022Quote: ... and 10% v/v human AB serum (Sigma-Aldrich). Recombinant human macrophage colony-stimulating factor (CSF1 ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human (rh) Interleukin-2 (IL-2, Sigma-Aldrich), rhTNFα (Peprotech ...
-
bioRxiv - Microbiology 2023Quote: ... Human embryonic kidney 293T cells (Cat. N° 12022001, Sigma) were cultured in DMEM-10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... or 2.5 µg of human plasma fibronectin (Sigma-Aldrich), or 1.5 µg of human complement C3b (Complement Technology ...
-
bioRxiv - Cell Biology 2023Quote: ... The Anti-human IGFBP2 ELISA kit (Sigma, #RAB0233-1KT) was used to quantify IGFBP2 protein in the supernatants according to the manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... were coated with anti-human polyvalent immunoglobulins (Sigma, I1761) in a 1:1000 dilution and stored at 4 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: FDT standards were prepared in human plasma (Sigma Aldrich), whereby 20 μL plasma samples were spiked with various known concentrations of [19F]FDT i.e ...
-
bioRxiv - Immunology 2023Quote: ... were coated with goat anti-human IgG (Sigma #I2136) antibody at a concentration of 4 µg/ ml diluted in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Human A2780 cells (catalog #: 93112519) were purchased from Sigma. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.5 mg/ml human recombinant albumin (Sigma Aldrich, A9731) and 0.2 mg/ml L-ascorbic acid 2-phosphate (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 IU of human chorionic gonadotrophin (HCG; Sigma-Aldrich) was administered ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2.5 μg/ml human recombinant insulin (Sigma, 19278). Wide-bore P1000 pipette tips with ∼3 mm diameter openings were used to transfer tumor pieces ...
-
bioRxiv - Cell Biology 2024Quote: pFN (human plasma FN (FC010) (Millipore,Burlington, MA, USA) was labelled with AlexaFluor568 or AlexaFluro680 according to instructions of the manufacturer (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... and 200 μL human serum (Sigma, St. Louis, MO). One 10 mL tube of whole blood yielded 1 mL of neutrophil-only solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... of Human chorionic gonadotropin (hCG) (Millipore Sigma, CG5-1VL). At 16 h post hCG injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg/ml human insulin (Sigma-Aldrich, I9278). At day 4 of differentiation ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.135 ng/mL human vascular endothelial growth factor (Sigma), 1 μg/mL hydrocortisone (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 µg/ml human insulin (Sigma-Aldrich, cat.no. I9278), 0.5 µg/ml hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: 100μg of Human Immunoglobulin type G (Sigma-Aldrich, 14506) or Bovin Serum Albumin are covalently linked to 3μm Polybead® Carboxylate Microspheres with PolyLink Protein Coupling Kit following manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µg per mL of human transferrin (Sigma-Aldrich) was included in the growth medium ...
-
bioRxiv - Microbiology 2023Quote: RENcell VM Human Neural Progenitor Cell Line (Sigma Aldrich) were cultured in medium comprising DMEM F-12 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 350 μL insulin human recombinant (Sigma-Aldritch, Cat. 11376497001)) supplemented with bFGF (10 ng/mL ...
-
bioRxiv - Immunology 2024Quote: ... with 5% v/v heat-inactivated human serum (Sigma), 1% v/v Glutamax (Gibco) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg/mL recombinant human insulin (Sigma-Aldrich, UK), 0.5 ng/mL recombinant human basic fibroblast growth factor ...
-
bioRxiv - Cancer Biology 2024Quote: ... and mouse anti-human anti-Vimentin (Sigma-Aldrich, CBL202) in 0.5% (v/v ...
-
bioRxiv - Genetics 2024Quote: The AC16 human cardiomyocyte cell line (Millipore Sigma SCC109) was cultured in Dulbecco’s Modified Eagle’s Medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10% heat inactivated Human AB serum (HS, Sigma-Aldrich), 6000 IU/ml recombinant human IL2 (Peprotech) ...
-
bioRxiv - Neuroscience 2024Quote: ... Ovulation was induced with human chorionic gonadotropin (Sigma CG10), and embryos were collected and manipulated according to standard procedure58 ...
-
bioRxiv - Pathology 2024Quote: To prepare the COLIV (derived from human placenta-Sigma) stock solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... or mouse anti-human BCL-XL (EMD Millipore MAB3121) antibodies were added to lysate aliquots and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: ... human myeloma IgE (0.3 µg/mL, Sigma-Aldrich, #401152) was used for sensitizing the cells in the presence of recombinant human IL-4 (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... human leukemia inhibitory factor (hLIF, 10 ng/ml, Millipore), SB431542 (2 µM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% human AB serum (Millipore Sigma, H4522), 2 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then washed twice 5 min in TBST and incubated with the primary antibody over night at 4°C (human and mouse a-syn: 610786 BD Biosciences; human α-syn: 804-258-1001, Enzo Life Science; beta-actin: A4700, Sigma). After incubation with the first antibody ...
-
bioRxiv - Immunology 2022Quote: Concentrations of human serum albumin in human plasma and bronchoalveloar lavage fluid were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0603) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... RPE-1 cells (ATCC® CRL-4000™) and Human foreskin fibroblasts (Hff1; ATCC® SCRC-1041™) were maintained in DMEM (Sigma) supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...