Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 10000+ citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 100 mIU/ml recombinant human chorionic gonadotropin (hCG) (Sigma), 500 ng/ml of A4 (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... and purified on collagen IV from human placenta (Sigma) and human plasma fibronectin (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... additionally containing 2.5 μg/mL human insulin (Sigma-Aldrich), 1X N2 Supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... 10 nM recombinant human (Leu15)-gastrin I (Sigma; G9145), 50 ng/mL recombinant human EGF ...
-
bioRxiv - Bioengineering 2024Quote: ... fibrinogen from human plasma (30 mg/mL Sigma-Aldrich), 50 U/mL thrombin (20 U ...
-
bioRxiv - Microbiology 2023Quote: ... were coated with human IgM (Sigma, Cat. #: I-8260) and incubated in rabbit anti-IgM (Sigma ...
-
bioRxiv - Genomics 2024Quote: ... pyruvate 10 mM and 10% human serum (Sigma, UK).
-
bioRxiv - Genetics 2024Quote: ... 20 ng/mL human EGF (Sigma Aldrich #E9644-.2mg), 0.5 mg/mL hydrocortisone (Sigma Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... and 100 U/ml human IL-2 (Sigma-Aldrich). After initial activation by plate-bound 0.05 µg of anti-CD3 (homemade ...
-
bioRxiv - Immunology 2024Quote: ... were coated with goat anti-human IgG (Sigma #I2136) antibody at a concentration of 4 µg/mL in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... Human PBMCs were purchased from Sigma (cat#HUMANPBMC-0002644) and were differentiated into macrophage by continuous culture in RPMI-1640 with L-glutamine (BI Biologics ...
-
bioRxiv - Molecular Biology 2024Quote: ... of Human chorionic gonadotropin (hCG) (Millipore Sigma, CG5-1VL). At 16 h post hCG injection ...
-
bioRxiv - Cancer Biology 2024Quote: Human Basic Fibroblast Growth Factor (hBFGF) (Sigma; CA#FO291)
-
bioRxiv - Cancer Biology 2022Quote: Expression of indicated Flag-tagged CDK6 constructs in HEK293 cells were determined via Western blotting with indicated Flag antibody [mouse anti-FLAG® M2-tag (Sigma-Aldrich, St. Louis, MO, USA, F3165-1MG)] ...
-
bioRxiv - Molecular Biology 2021Quote: ... After washing Laemmli buffer 1X was added followed by boiling and loading on SDS-PAGE for visualization by western blotting using anti-His (Clonetech 631212) and anti-GST (Sigma G1160) antibodies.
-
bioRxiv - Molecular Biology 2020Quote: ... coli cells and large quantities of His6 tagged recombinant Nbs were purified with 1ml of HIS-Select Nickel Affinity Gel (Sigma-Aldrich) following periplasmic expression through osmotic shock ...
-
bioRxiv - Microbiology 2019Quote: ... cells were resuspended in 50 μL stain buffer (FACS buffer containing Qiagen Penta-HIS Alexa Fluor 647 #35370 at a final concentration of 5 μg/mL and Sigma-Aldrich Monoclonal Anti-HA-FITC ...
-
bioRxiv - Cancer Biology 2019Quote: ... Immunoprecipitates were then washed three times with cold Triton lysis buffer and were analyzed by western blot using an anti-His antibody (Sigma Aldrich).
-
bioRxiv - Plant Biology 2020Quote: ... The supernatant was then centrifuged at 15000 g for 30 min and applied onto a Ni2+ Hitrap chelating resin (HIS-Select Nickel Affinity Gel; Sigma-Aldrich) equilibrated with 30 mM Tris-HCl pH 7.9 containing 500 mM NaCl (TN buffer ...
-
bioRxiv - Microbiology 2020Quote: ... pLysS cells expressing His-topoIB and T18 tagged genome segregation proteins in different combinations using the kit Protein G immunoprecipitation from Sigma-Aldrich as described previously (Maurya et ...
-
bioRxiv - Systems Biology 2021Quote: ... The pellet was diluted using 250 μL of drop-out medium His− (Yeast Synthetic Drop-out Medium Supplement without Histidine, Sigma Y1751) at 1.92 mg/mL initial concentration ...
-
bioRxiv - Microbiology 2020Quote: ... cells were normalized to OD600=0.001 in 1XPBS (phosphate-buffered saline) with 10% of Heat inactivated Fetal Bovine Serum (HI-FBS) (Sigma-Aldrich F9665) and incubated at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Recombinant His-tagged proteins were purified from cell lysates on a nickel-chelating column (Ni-nitrilotriacetic acid agarose; His-select high flow nickel affinity gel; Sigma-Aldrich), as described previously [53] ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 ug inactive MEK1 (C-terminally His-tagged) in a total volume of 40 μL buffer (20 mM Hepes pH 8 (MERCK, Sigma Aldrich, catalogue No ...
-
bioRxiv - Neuroscience 2020Quote: ... was tagged with 6xHis at the C-terminus using PCR amplification and the modified Tau-His cassette was introduced into pET3a plasmid (Novagen, DE) linearized with NdeI enzyme succeeding in pET3a/htau40/6xHis plasmid for the protein expression in E.coli ...
-
bioRxiv - Biochemistry 2020Quote: ... N-terminally His-tagged MpPA14 was incubated with the array and binding of the lectin to the polysaccharides was detected by an anti-His tag secondary antibody conjugated to alkaline phosphatase (Sigma-Aldrich). Microarray probing and quantification were performed as previously described(41).
-
bioRxiv - Plant Biology 2020Quote: ... The protein was separated on a 10% SDS-PAGE gel and further analyzed by immunoblotting using anti-His and anti-GST antibody (Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... Purified proteins were mixed as indicated in the figure and rotated with either HIS-Select HF Nickel Affinity Gel (Sigma-Aldrich) or Glutatione Sepharose 4B (GE healthcare ...
-
bioRxiv - Physiology 2020Quote: ... 1.8 mM KCl and 1.25 mM NaHCO3) before they were transferred to dissociation buffer [HBSS supplemented with 5% heat-inactivated fetal bovine serum (HI-FBS, Sigma, F2442) and 10 mM HEPES (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... cells were normalized to OD600=0.001 in 1x PBS (phosphate-buffered saline) with 10% of Heat inactivated Fetal Bovine Serum (HI-FBS) (Sigma-Aldrich F9665) and incubated at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... The lysate was nutated with 200 μL of Ni-NTA resin (Roche cOmplete™ His-Tag purification resin, Millipore Sigma #5893682001) at 4°C for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... and then monoclonal anti-6x(HIS)-tag antibody was probed followed by detection with anti-mouse IgG conjugated with alkaline phosphatase (A3562: 1ml Sigma, USA) was used for developing the blots.
-
bioRxiv - Immunology 2022Quote: ... To prepare HI-WCA-OT-109 copies/ml of bacterial suspension was made up in R10 media: RPMI 1640 (Sigma, R0883) containing 10% heat-inactivated FBS (Gibco ...
-
bioRxiv - Plant Biology 2023Quote: ... All ATG3 recombinant proteins (wild-type and Cys-to-Ser mutants) were purified by affinity chromatography on a His-Select Nickel Affinity Gel (Sigma, P6611) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 10% input aliquots were taken and the rest of the sample was incubated with HIS-Select® Nickel Magnetic Agarose Beads (Sigma) for 1 h ...
-
bioRxiv - Biochemistry 2023Quote: ... was concentrated from the flow-through of the second passage through the His-trap column using an Amicon® Ultra Centrifugal Filter (Millipore) with a 30 kDa cut-off ...
-
bioRxiv - Cell Biology 2023Quote: ... The unbound portion of this capture step was kept as HIS-free eGFP protein and conjugates and concentrated once on a 10K Amicon column (Millipore Sigma) by spinning for 6-8 minutes at 6000x g ...
-
bioRxiv - Immunology 2023Quote: ... 293FT were exposed to supernatants containing pMXs-IRES-Blast-STING-His retroviruses and 4 μg/mL polybrene (Millipore, TR-1003-G). Two days post transduction ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µL from the supernatant and cell lysates were applied on a nylon membrane and two different antibodies (an HRP-conjugated anti-His tag from Qiagen and an HRP-conjugated anti-strep tag from Sigma-Aldrich) were used on separate blots to detect PR3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1.8 mM KCl and 1.25 mM NaHCO3) before they were transferred to dissociation buffer [HBSS supplemented with 5% heat-inactivated fetal bovine serum (HI-FBS, Sigma, F2442) and 10 mM HEPES (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... the soluble fraction (obtained by centrifugation with 13000g at 4°C for 30 min) was applied to His-Select Nickel Affinity Gel (Sigma-Aldrich) in presence of 5 mM imidazole for 2h on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... The tissues were mashed through a 70-μm cell strainer in PBS / 2% heat-inactivated fetal bovine serum (HI-FBS; Sigma-Aldrich) / 10 mM EDTA-Na (pH 8.0) ...
-
bioRxiv - Physiology 2023Quote: ... Samples were stored at −20°C and insulin secretion was measured using a mouse insulin radioimmunoassay kit (Millipore Cat# HI-14K).
-
bioRxiv - Microbiology 2019Quote: ... RPE-1 cells (ATCC® CRL-4000™) and Human foreskin fibroblasts (Hff1; ATCC® SCRC-1041™) were maintained in DMEM (Sigma) supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...