Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 10000+ citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... or GABA (5 μM, Sigma-Aldrich). Cells were then imaged in 96-well plates every min for 60-90 min (Zeiss Observer Z.1) ...
-
bioRxiv - Microbiology 2020Quote: ... + 5 mg/ml driselase (Sigma, D9515) and incubated for approximately 17 hours at 30°C in a shaking water bath (65 rpm) ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5% β-mercaptoethanol (Sigma-Aldrich), and boiled at 95°C for 5 minutes prior to loading ...
-
bioRxiv - Cell Biology 2020Quote: ... cilengitide (5 μM, SML1594, Sigma-Aldrich). Where indicated ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg FLAG antibodies (Sigma F1804) were used for each experiment and 25 μl slurry Protein A/G UltraLink Resins (ThermoFisher 53133 ...
-
bioRxiv - Microbiology 2020Quote: ... mixtures containing 5% acrylamide (Sigma; A4058) and 0.1% bis-acrylamide (Fisher ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 mM L-Glutamine (Sigma G3126), and 0.1 mg/mL insulin (human recombinant ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5-10% FBS (Sigma Aldrich). Cells were cultured with 5% CO2 and at 37°C in a humidified incubator ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM β-Glycerophosphate (Sigma #G6251), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% human serum (Sigma) and 0.5 mM β-mercaptoethanol at density of 106 cells/mL ...
-
bioRxiv - Microbiology 2021Quote: ... Flag (1:5, 000; Sigma, F1804) were used for protein detection ...
-
bioRxiv - Immunology 2020Quote: ... 5 μM rotenone (Sigma Aldrich R8875) together with 5 μM antimycin A (Sigma Aldrich A8674 ...
-
bioRxiv - Cell Biology 2020Quote: ... or 5% skimmed milk (Sigma-Aldrich), in TBS/0.1% Tween 20 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 mM β-mercaptoethanol (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2019Quote: ... 5 mM β-mercaptoethanol (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... 5 pM triiodo-L-thyronine (Sigma), 10 ng/mL recombinant human EGF (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μM beta - mercaptoethanol (BME; Sigma) and Leukemia Inhibitory Factor (LIF ...
-
bioRxiv - Immunology 2019Quote: ... 5% (v/v) goat serum (Sigma), 5% (v/v ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5-fluorouracil (20 μM, Sigma) to remove proliferating cells.
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 5% horse serum (Sigma), 10 ng/ml cholera toxin (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... 5 μg/ml trimethoprim (Sigma-Aldrich), and 10 μg/ml vancomycin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 μg/mL erythromycin (Sigma) were incorporated into the growth medium ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 % bovine serum albumin (BSA, Sigma) in PBS was used for 45 minutes at RT for blocking ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 g/L NaCl (Sigma). The InSPI2 medium was based on PCN (pH 5.8 ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 5% horse serum (Sigma), 100 ng/ml cholera toxin (Sigma) ...
-
bioRxiv - Systems Biology 2021Quote: ... supplemented with 5% FBS (Sigma, #F7524) and Penicillin-streptomycin (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5% (w/w) cholesterol (Sigma). The resulting lipidic mesophase was dispensed as 50 μL drops into 96-well glass plates and overlaid with 0.8 μL of precipitant solution using an NT8-LCP crystallisation robot (Formulatrix ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 mM protocatechuic acid (Sigma 37580), 1:500 recombinant protocatechuate oxidase 3,4-dioxygenases (rPCO 46852004 ...
-
bioRxiv - Immunology 2021Quote: ... solutions containing 5% sucrose (S9378, Sigma), 1.125% sodium chloride (S3014 ...
-
bioRxiv - Physiology 2021Quote: ... 5%DSS (Sigma, #9011-18-1) 2mM paraquat (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml apo-transferrin (Sigma) and 13 ng/ml liothyronine (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of Benzonase Nuclease (Novagen) and MgCl2 (1 mM final concentration ...
-
bioRxiv - Cancer Biology 2021Quote: ... and stained in 5% Giemsa (Sigma) for 15 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... Coumarin (Sigma-Aldrich, 91-64-5), Sucrose octaacetate (Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: 5-Bromo-2′-deoxyuridine (BrdU, Sigma) was dissolved in drinking water at a final concentration of 0.8 mg/ml and given to P28.5 mice for 7 consecutive days ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% donkey serum (Sigma-Aldrich) were added to the permeabilisation solution and this was also used for blocking for 1h at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 5% horse serum (Sigma), 100 ng/ml cholera toxin (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... SB290157 (Sigma, 1 μM 5 min), anti-CD18 clone GAME-46 or isotype control (BD ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5% fetal bovine serum (Sigma) at 37 °C with 5% CO2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μg/L Vitamin B12 (Sigma), 4 mg/L FeSO4·7H2O (Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 g/L glucose (Sigma). Cultures were grown in an anaerobic chamber with an atmosphere of 2% H2 balanced with N2 and CO2 at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... Concanavalin A (Sigma, 5 μg/mL) was used as positive control ...
-
bioRxiv - Immunology 2021Quote: ... with 5% β-mercaptoethanol (Sigma-Aldrich). Samples were separated on 4% to 12% gradient gels (NuPAGE ...
-
bioRxiv - Neuroscience 2021Quote: ... pargyline (Sigma-Aldrich; 5 mg/kg), S(-)raclopride (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coelenterazine-h (5 µM, Sigma-Aldrich) was then injected and the Renilla luciferase activity was assessed for the first 10 seconds using Infinite200Pro (Tecan ...
-
bioRxiv - Cell Biology 2019Quote: ... with 5% horse serum (HS) (Sigma), 10 µg/ml Insulin (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 mM ATP (A2383, Sigma Aldrich), and 0.03 % sodium cholate (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich), the coding sequence of Chk1 (5’GAAGCAGUCGCAGUGAAGA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% fetal bovine serum (FBS)(Sigma), 100U/ml penicillin and 100 μg/ml streptomycin (Nacalai Tesque ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM EGTA (Sigma cat. # E4378), 2 mM MgCl2 ...