Labshake search
Citations for Millipore Sigma :
1701 - 1750 of 3976 citations for Chlortoluron N N Dimethyl D6 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the cuticula was fixed in its original position using n-eicosane (Sigma Aldrich). The bees were stored in a dark ...
-
bioRxiv - Microbiology 2020Quote: ... 50 μg/ml tanespimycin (17-N-allylamino-17-demethoxygeldanamycin, 17-AAG, Sigma-Aldrich), and/or 1 mM hydrogen-peroxide (H2O2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... organoids were mounted with 0.1% (w/v) n-propyl gallate (Sigma Aldrich, P3130) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% glycerol) with protease inhibitors and 5 mM N-ethyl maleimide (NEM, Sigma) and incubated for 2 hours at 4°C followed by centrifugation of extract for 30 min at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The lipid film was further washed three time with n-pentane (Sigma-Aldrich) and lyophilized overnight ...
-
Methacrylic acid-based biomaterials promote peripheral innervation in the subcutaneous space of micebioRxiv - Bioengineering 2022Quote: Some mice (N=3) were administered the IGF-1 inhibitor Tyrphostin AG1024 (Sigma) daily beginning on the day of hydrogel implantation for 21 days ...
-
bioRxiv - Biophysics 2020Quote: ... For construct-2 with modified N-terminus we used thrombin protease (Sigma, USA) to get rid of the N-terminal hexa-histidine tag ...
-
bioRxiv - Neuroscience 2020Quote: ... Nicotine-exposed dams (n = 23) received 15 mg nicotine hydrogen tartrate salt (Sigma) per liter of drinking water sweetened with 1% sucralose to increase palatability ...
-
bioRxiv - Neuroscience 2021Quote: ... and subsequently incubated with GAD67 antibody O/N (1:500 MAB5406, Merck-Millipore) in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then mounted in 80% glycerol + 0.5% N-propyl-gallate (Sigma-Aldrich) and imaged with a ZEISS LSM500 or ZEISS LSM800 or Olympus FV3000 confocal microscopes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cultures were run in triplicate in EliSpot multiwell plates (Millipore, cat n. MSPS4510) pre-coated with the AN18 mAb against mouse IFN-γ (Mabtech ...
-
bioRxiv - Immunology 2022Quote: ... cartridges were washed with H2O (LC-MS grade) and n-hexane (Sigma-Aldrich), followed by elution using methylformate (spectrophotometric grade ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected N-methyl-D-aspartic acid (NMDA) (Sigma-Aldrich; St. Louis, MO) intravitreally (52) ...
-
Orange is the new white: taxonomic revision of Antarctic Tritonia species (Gastropoda: Nudibranchia)bioRxiv - Zoology 2020Quote: ... 3.3 μL REDExtract-N-Amp PCR ReadyMix (Sigma Aldrich, St. Louis, MO, USA), 0.3 μL of each primer ...
-
bioRxiv - Pathology 2020Quote: ... N-acetyl-L-cysteine (1 mM, Sigma, RSPO1-conditioned medium (10% v/v), Noggin-conditioned medium (10% v/v) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 24 hour post-fertilization embryos were treated with 200µM N-Phenylthiourea (Sigma # P7629) to prevent melanocyte formation ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA was extracted using the REDExtract-N-Amp Tissue PCR Kit (Sigma): 50 µl of extraction solution and 12.5 µl of tissue preparation solution was added to each embryo ...
-
bioRxiv - Biochemistry 2019Quote: ... The n-alkanes (C6-C30) standard were obtained from Sigma-Aldrich (Shanghai, China). All the standards compounds were of GC quality.
-
bioRxiv - Microbiology 2019Quote: ... glucosamine (GlcN) or N-Acetyl-D-glucosamine (GlcNAc) (Sigma Millipore, St. Louis, MO). Cultures were maintained at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... glucosamine (GlcN) or N-Acetyl-D-glucosamine (GlcNAc) (Sigma Millipore, St. Louis, MO). Cultures were maintained at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... a lysation buffer containing 0.5 % (w/v) N-lauroylsarcosine (Sigma Aldrich L9150-50G), 50 mM Tris-HCl (Thermo Fisher Scientific 15568025) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5-Carboxyfluorescein N-Succinimidyl ester (CFSE) fluorescent dye was obtained from Sigma-Aldrich. AlexaFluor-488-microscale labelling kit was from ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... brucei proton pump inhibitor N-ethylmaleimide (NEM) were all purchased from Sigma-Aldrich. New compounds synthesised for this study are listed and described in the Supplemental Materials.
-
bioRxiv - Cell Biology 2020Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Primary antibodies used for immunofluorescence were mouse anti-acetylated tubulin (clone 6-11B ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated at 4°C O/N with primary α-FLAG (Millipore F1804-5MG) or α- beta-Actin (Abcam ab8224 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rewashed and mounted using antifade (0.2% N-propyl gallate in 75% glycerol; Sigma). The fluorescence was visualized under an Echo-Revolve fluorescence microscope at a magnification of 200X ...
-
bioRxiv - Microbiology 2020Quote: ... N-linked glycans were purified on a Nafion® 117 membrane (Sigma-Aldrich) prior to injection ...
-
bioRxiv - Immunology 2020Quote: ... Cultures were run in triplicate in EliSpot multiwell plates (Millipore, cat n. MSPS4510) pre-coated with the AN18 mAb against mouse IFN-γ (Mabtech ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM N-ε-acetyl-lysine (Sigma-Aldrich Co., St. Louis, MO), to ensure that this non-canonical amino acid did not limit the expression of the Ac-K atACS variant ...
-
bioRxiv - Genomics 2022Quote: ... we gently denatured the histones by treating with 0.1 N HCl (Sigma H9892) diluted in water for 5 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... mouse monoclonal IgG2aĸ antibody with epitope matching the N-terminus (EMD Millipore #MABS1920), nuclear matrix protein p84 [EPR5662(2)] rabbit monoclonal antibody mapping with aa350-450 (abcam #ab131268) ...
-
bioRxiv - Systems Biology 2022Quote: ... A 1-hour pretreatment with 2mM N-acetyl cysteine (NAC; Sigma-Aldrich, A9165) was accomplished by addition to all staining ...
-
bioRxiv - Molecular Biology 2022Quote: ... Coverslips were mounted on slides using 3% (w/v) n-propyl gallate (Sigma) in an 80% glycerol solution and sealed with clear nail varnish ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich).
-
bioRxiv - Microbiology 2022Quote: ... Parasites were grown to >4% parasitaemia when 50 mM N-Acetylglucosamine (Sigma Aldrich) was added to the culture to eliminate asexual stages ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-indolylacetyl)-DL-aspartic acid (IAA-Asp; Sigma-Aldrich, St. Louis, MO), (+/-)-jasmonic acid (JA ...
-
bioRxiv - Biochemistry 2024Quote: ... Fresh stocks of the monovalent reagents N-(propionyloxy)succinimide ester (PropNHS, Sigma-Aldrich), Biotin-X-NHS (Biotin-NHS ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing N-WASP were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) and further purified by size exclusion chromatography using a Superdex 200 prepgrade column (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... coverslipped using a mounting media solution of 0.5% N-propyl gallate (Sigma-Aldrich) and 90% glycerol in ddH2O ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: Snap-frozen placental samples (n=25) were lyzed in TRI Reagent (Sigma-Aldrich) using the RETCH MM 400 Mixer Mill (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... β-hexosaminidase substrate (4-nitrophenyl N-acetyl-β-D-glucosaminide, 4 mM, Sigma) was then added to the supernatant and lysate for 1 h at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: WT and emx2el586/el586 heterozygous incrosses were incubated in 0.003% N-Phenylthiourea (Sigma). At 48 hpf ...
-
bioRxiv - Microbiology 2024Quote: ... 30 mM 3-(N-Morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, Product No. 69947) was used as a buffering agent at pH at 7 during the experimental time course ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received intraperitoneal injections of clozapine-N-oxide (CNO, Sigma, dissolved in saline) 10 minutes prior to the resident-intruder test.
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Biochemistry 2023Quote: ... Negative control samples were prepared using 10 mM N-ethymaleimide (NEM, Sigma-Aldrich) instead of mPEG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and N-acetyl-L-cysteine (NAC) (A9165) were from Sigma (Burlington, MA, USA). Rat tail collagen (354236 ...
-
bioRxiv - Physiology 2023Quote: ... DNA extraction was done using REDExtract-N-Amp Tissue PCR kit (XNAT, Sigma). For the PCR reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... culture medium consisting of advanced DMEM/F12 supplemented with N-Acetylcysteine (Sigma-Aldrich), B plus supplement (bioGenous) ...
-
bioRxiv - Biophysics 2023Quote: ... sodium chloride and trimethylamine N-oxide (TMAO) were all purchased from Sigma-Aldrich as previously reported (15,18-23) ...