Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Protein concentration was measured by BCA Protein Assay Kit (Sigma-Aldrich) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Thirty microliters of protein G/protein A agarose beads (EMD Millipore) were washed with lysis buffer (containing protein inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... The protein concentration was determined by a BCA protein assay (Sigma). A total of 50 µg protein extract was mixed with 5× Laemmli loading buffer (50% glycerol ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was determined using the BCA protein determination reagent (Sigma), and 50 μg were resolved on an SDS/PAGE denaturing gel and transferred to a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was determined using the BCA protein determination reagent (Sigma), and 60 μg were resolved on an SDS/PAGE gel and transferred to a nitrocellulose membrane ...
-
bioRxiv - Microbiology 2024Quote: ... then removed the proteins with a 10K MWCO protein concentrator (Millipore) and quantified the resulting HOSCN solution (typically 3.5 to 4 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein quantification was performed with the BCA Protein Assay Kit (Millipore); for each sample ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were detected by Western blotting using anti-Protein A from rabbit (for detecting TAP fusion proteins; P3775; Sigma), anti-Gsp1 from rabbit (Makhnevych et al. ...
-
bioRxiv - Immunology 2020Quote: ... Protein extracts were then precleared with protein G beads (EZview™ Red Protein G Affinity Gel, Sigma-Aldrich, Israel), following incubation for 30 min at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Ultrafine anaphase bridges in U2OS osteosarcoma cells exogenously expressing wild-type POT1 and POT1-ΔOB were detected using the mouse monoclonal anti-PICH antibody (clone 14226-3; Millipore, 04-1540; 1:100 dilution), by following the co-extraction protocol described by (Bizard et al ...
-
bioRxiv - Physiology 2019Quote: ... This was followed by the application of cleaved caspase-3 antibody diluted 1:200 in PBS with 1% Bovine Serum Albumin (BSA; Sigma Aldrich Chemie GmbH, Steinheim, Germany) and incubation overnight at 4°C ...
-
bioRxiv - Plant Biology 2019Quote: ... The antigen–antibody complexes were visualized using nitrotetrazolium blue chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) buffer (Sigma-Aldrich, St. Louis, Missouri, USA) under standard conditions ...
-
bioRxiv - Genetics 2021Quote: ... Coverslips were incubated with primary antibodies in 3%BSA for 1 hr at room temperature: monoclonal anti-SMN (05-1532 Sigma-Aldrich clone 2B1, 1:1000); rabbit anti- Coilin (H300 Santa Cruz SC-32860 ...
-
bioRxiv - Bioengineering 2021Quote: ... Western blot analysis was performed using a primary antibody of rabbit anti-protein A (1:25,000 dilution) (Sigma-Aldrich, St. Louis, MO) and a secondary antibody of goat anti-rabbit IgG-HRP (1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... in PBS at 37°C for 30 minutes and subsequently incubated for two hours with a 1:200 concentration anti-glial fibrillary acidic protein (GFAP) antibody produced in mouse (Sigma, 1:200) and 1:500 concentration anti-β-Tubulin III antibody produced in rabbit (Sigma ...
-
bioRxiv - Immunology 2021Quote: Transiently expressed antibodies were purified from 30 ml of HEK 293 Expi cultures using Protein G GraviTrap columns (Sigma, GE28-9852-55) and the Ab Buffer Kit (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... SDS-PAGE and western blot analyses were used to detect proteins and modifications using the following antibodies: anti-phospho SMAD2 (Ser465/467, Sigma, 1:500), Smad2 Polyclonal Antibody (Life Technologies 1:500 ...
-
bioRxiv - Neuroscience 2022Quote: Proteins were resolved by SDS-PAGE and proteins were detected and quantified by immunoblotting with the following antibodies: rat anti-DAT (MAB369, Millipore; 1:2000), rabbit anti-TH (AB152 ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The ratio of protein level or phosphorylation levele against control β-actin protein level (detected with a mouse monoclonal Anti-β-Actin-Peroxidase antibody (A3854 Sigma)) was normalized to untreated wt sample mean.
-
bioRxiv - Microbiology 2019Quote: ... Relative TLR3 protein expression levels between WT and CRISPR modified cells were obtained by measuring TLR3’s expression against the intracellular β-Actin control protein bound to an anti-β-Actin monoclonal antibody (1:300; Sigma). Protein detection in WES was accomplished according to the manufacturer’s protocol using streptavidin-HRP based methodology (ProteinSimple) ...
-
bioRxiv - Pathology 2020Quote: ... Proteins were immunoblotted with antibodies against FECH (rabbit, 1:400, LS Bio, #LSC409953, and β-actin (mouse, 1:5000, Sigma-Aldrich, AC40). Secondary antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... coverslips were labeled with antibodies as follows: HA-tagged proteins were detected with rat anti-HA 3F10 (Sigma 1:200-1:500), parasitophorous vacuole with in-house mouse anti-MAG1 (1:500) ...
-
bioRxiv - Genomics 2021Quote: ... Eluted proteins were then analyzed by western blotting with anti-U1-70k mouse monoclonal antibody (9C4.1) (05-1588, Merk Millipore, Burlington, MA, USA) at a dilution of 1:500 for the detection of U1-70k ...
-
bioRxiv - Molecular Biology 2021Quote: ... TMG-capped RNAs were isolated from RNase H-treated immunoprecipitates with Protein G Dynabeads coated with an α-TMG antibody (Sigma, MABE302), according to 59.
-
bioRxiv - Cell Biology 2021Quote: ... Samples were boiled in 2x sample buffer for 5 min to elute the proteins and analyzed by SDS-PAGE followed by Western blot using anti c-myc antibody (Sigma-Aldrich, #C3956).
-
bioRxiv - Microbiology 2020Quote: ... Proteins were separated by SDS-PAGE and visualized by Western blot analysis using primary antibodies for FLAG (Clone M2, Sigma-Aldrich, F1804) and HA (Roche ...
-
bioRxiv - Immunology 2020Quote: ... Total protein in the cell lysate was estimated using the Lowry assay and 30 µg total protein from each cell lysate was used for immunoblotting with anti-HA antibody (Cat# H9658, Sigma, 1:10000), anti-AU1 antibody (Cat# ab3401 ...
-
bioRxiv - Neuroscience 2022Quote: ... Astrocytosis was assessed by glial fibrillary acidic protein (GFAP) staining using a Cy3-conjugated anti-GFAP antibody (1:200; C 9205, Sigma, Oakville, ON). Brain levels of Bdnf and Htt were determined by western blotting using protein lysates from either whole brain or microdissected brain sections with the following antibodies ...
-
bioRxiv - Immunology 2022Quote: ... Membranes were blocked in 5% BSA in TBST and incubated overnight with primary antibodies targeting the following proteins: FLAG (M2; Sigma; 1:1000), phosphorylated tyrosine (P-Y-1000 MultiMab ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sixty μl of Dynabeads Protein G were incubated for 1h30 at 4°C under agitation with 16 μg of the anti-Ago2 antibody (Sigma-Aldrich, SAB4200085) in 1X PBS containing 0.1% of Tween 20 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membranes were blocked with 5% skim milk in TBST and target proteins were detected with ANTI-FLAG® M2 antibody (Sigma-Aldrich) and anti-α-tubulin (SantaCruz).