Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 3014 citations for 6 bromochromone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... UFM1 (GCTGTGAAAGGTGTACTTTC) and UFC1 (GTGACAACGATTGGTTCCGAC) followed by selection with 75 µg/ml 6-thioguanine (Sigma-Aldrich, A4882) 4 days after electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell nuclei were stained with DAPI (1:1000, 4’ s-6-diamidino-2-phenylindole, Sigma Aldrich, USA) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 6-day-old perithecia with TRI Reagent (Sigma-Aldrich, cat. no. T9424) and re-suspended in 5M urea ...
-
bioRxiv - Immunology 2020Quote: ... T cells were also stimulated for 6 hours with 50ng/ml PMA and 1μg/ml Ionomycin (Sigma). T cells were then harvested ...
-
bioRxiv - Molecular Biology 2021Quote: Melanoma cells treated with ARN22089 for 6 or 24 h and lysed in RIPA buffer (EMD Millipore or an optimized cocktail (250 mM NaCL ...
-
bioRxiv - Microbiology 2021Quote: ... approximately 3 to 6 L of diffuse flow fluid were pumped through 0.22 μm Sterivex filters (Millipore). Shipboard ...
-
bioRxiv - Developmental Biology 2021Quote: Adult fish (between 3-6 mpf) were anesthetized by immersion into 0.04% tricaine (Sigma, St Louis, MO) and the AF were carefully detached using surgical blade and forceps ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the embryos were treated for 6 days with 0.003% N-phenylthiourea (PTU) (Sigma, St Louis, MO) to inhibit pigment formation.
-
bioRxiv - Genetics 2020Quote: ... HUT 78 cells were treated up to 6 hours with 1 μM of romidepsin (Sigma-Aldrich, SML1175), DMSO being used as a control ...
-
bioRxiv - Genetics 2020Quote: ... cells were permeablised first with 1ml/well (6-well plate) mTESR1 medium with 8μg/ml polybrene (Millipore) for 15 min (37°C) ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 g (±5 g) female C57BL/6 mice were injected intraperitoneally (I.P) with LPS (L-5886, Sigma). EVs were I.V injected via the tail vein subsequent to LPS induction and the animals were observed and weighed daily after induction ...
-
bioRxiv - Microbiology 2020Quote: ... 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2022Quote: ... and digested in 6 ml of 2-mg/mL type II collagenase (Sigma # C6885 or Worthington #LS004177) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 μg TRC2-pLKO-puro vector encoding shRNA (TRCN0000377256-NM_005871.3-637s21c1, designated here as shSMNDC1-6, or TRCN0000369078-NM_005871.3-724s21c1, designated here as shSMNDC1-7, Sigma) targeting different sequences of SMNDC1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Successfully transduced cells were then selected using blasticidin (6 µg/ml, Cat. no. 15205, Sigma-Al- drich). For the experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were stained using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma Aldrich-Aldrich, Catalog No-D9542).
-
bioRxiv - Cell Biology 2022Quote: ... fibroblasts were seeded at 2.25×104 into each well of 6 well dishes (Millipore Sigma Cat. CLS3516) in 2ml complete M106 on Day 0 and grown overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of RNA replicons were transfected into 105 fibroblasts on 6-well plates using RiboJuice (Sigma) in the presence of 100 ng/ml B18R (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Adult mice (7 week old) mice were injected with 6 mg of Tamoxifen in Corn Oil (Sigma) intraperitoneally for 3 days ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with DAPI (4’,6-diamidino-2-phenylindole) (0.1 ng/μL, Sigma-Aldrich, cat. # D9542) for 5 min to exclude dead cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1x in wash buffer containing 0.1 μg/ml 4′,6-Diamidino-2-phenylindole dihydrochloride (Millipore Sigma, D8417), and 1x in wash buffer for 5 min each ...
-
bioRxiv - Genetics 2022Quote: ... UMOD-GFP cells were treated for 6 h with 2.5 μM proteasome inhibitor MG132 (M8699, Sigma-Aldrich). Protein samples were collected at 2 ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... the barcode beads were washed three times in 6 x SSC buffer (Sigma, catalog no. S0902-1L) and loaded into Countess (Thermo-Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with the nuclear dye 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, Germany) and actin filaments were labeled with ATTO 647-phalloidin conjugate (Hypermol EK ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 weeks aged mice were fed with drinking water containing 50 μg/mL 4NQO (Sigma-Aldrich, N8141) for 16 weeks and then given normal drinking water for additional 10 weeks ...
-
bioRxiv - Neuroscience 2023Quote: ... confluent wells in a 6-well plate were incubated with 20mM NH4Cl (Sigma-Aldrich, St Louis MO) and 300μM leupeptin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-8 weeks-old mice were intraperitoneally injected with 0.1mL of 10mg/mL 4-hydroxytamoxifen (Sigma Aldrich) dissolved in a solution of DMSO ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-week- old male mice were injected with 25 mg/kg LPS (Sigma Aldrich, St. Louis, MO) or PBS above calvariae ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 mM 4-methylumbelliferyl N-acetyl-β- D-glucosaminide-6-sulfate (HEXA; Sigma Aldrich, MS, USA) in 0.1 M citric acid/NaOH buffer (pH 4.4 ...
-
bioRxiv - Systems Biology 2024Quote: ... 6 - 10 worms were then randomly picked in a drop of 20 mM tetramisole (Cat. T1512, Sigma) and then aligned on an empty NGM plate ...
-
bioRxiv - Systems Biology 2024Quote: ... and reporter cell lines (170,000 cells) were transduced in the presence of 6 µg/ml polybrene (Sigma). Cells were harvested 24 hours later and plated in medium containing 1 µg/ml Puromycin (InvivoGen ...
-
bioRxiv - Developmental Biology 2024Quote: ... fibroblasts were collected and transferred equally to a 6-well plate coated with Matrigel in DMEM (Sigma) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently transduced two times with viral supernatant in the presence of 6 ug/ml polybrene (Sigma) and 50 U/ml IL-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... a mAb against Acetylated α-tubulin (clone 6-11B-1; Sigma-Aldrich, Cat. Number: T7451, RRID: AB_609894) diluted 1:1000 or 1:200 for STED microscopy and a rabbit polyclonal antibody against detyrosinated (Glu ...
-
bioRxiv - Neuroscience 2024Quote: ... vibratome sections were counterstained with 1:1000 DAPI (4ʹ,6-diamidino-2-phenylindole, 1 mg/ml, Sigma) in PBS and incubated for 20 minutes in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... EAE was induced in C57BL/6 mice by immunization with oligodendrocyte glycoprotein 35–55 (200 μg; Sigma) in incomplete Freund’s adjuvant supplemented with Mycobacterium tuberculosis H37Ra ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 6 PBSTx washes and incubation with anti-DIG antibody (1:1,500; CAT 11207733910; Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... hypothalamic tissue was homogenized in 100% methanol containing 1 mM 6-propyl-2-thiouracil (PTU) (Sigma, H34203) in a glass-glass tissue grind pestle (60mm ...
-
bioRxiv - Immunology 2024Quote: ... 6-FP was washed off and the cells treated with 50 μg/ml Brefeldin A (BFA, Sigma) or the equivalent volume of DMSO (Sigma ...
-
bioRxiv - Genomics 2024Quote: ... Samples were incubated with primary antibodies (mouse anti-acetyl-alpha tubulin antibody, clone 6-11B-1 [Millipore-Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... mice at 6 to 8 weeks of age were conditioned with busulfan (Sigma, St. Louis, MO, USA) injected intraperitoneally (25 mg/kg body weight/day ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then 0.2 mL of washed IgG Sepharose 6 Fast Flow beads (Millipore Sigma, Cat#: GE17-0969-01) were added to each sample and incubated on a rotisserie mixer for 0.5 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All medium for microfluidic experiments contained 20mg/L Pluronic F127 surfactant (CAS 9003-11-6, Sigma-Aldrich).
-
bioRxiv - Systems Biology 2022Quote: ... Shapes were then re-suspended in 6 μL of 80 mM triethylammonium bicarbonate buffer (pH 8.5, Sigma) with 0.013% dodecyl-β-D-maltoside (DDM ...
-
bioRxiv - Cell Biology 2023Quote: ... at density .5×106 cells / 6-well plate coated with gelatin (Millipore, cat. no. ES-006-B). Cells were cultured in basic culture media (described above ...