Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations for Tumor necrosis factor receptor superfamily member 3 TNFRSF3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Human thrombin (Sigma, #T6884-100UN) was reconstituted in sterile 0.9% saline supplemented with human serum albumin (0.1% w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... thrombin (from human plasma, Sigma) and aprotinin (from bovine lung ...
-
bioRxiv - Immunology 2024Quote: ... 10% human serum (Sigma-Aldrich), 100 U/ml Penicillin (Cellgro Technologies LLC) ...
-
bioRxiv - Immunology 2024Quote: ... 5% human AB serum (Sigma), 500 IU/mL of IL-2 (Proleukin S ...
-
bioRxiv - Molecular Biology 2024Quote: Recombinant human PDE8A (Sigma SRP0273) was incubated with 100 ng FAK tyrosine kinase (Promega #V1971 ...
-
bioRxiv - Molecular Biology 2024Quote: Human serum (Sigma-Aldrich, H4522) was thawed on ice and centrifuged at 18,000 ×g for 10 min at 4 °C to remove lipids ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... medium was replaced by Greens medium containing epidermal growth factor (EGF, 10 ng/ml; Sigma), cells were expanded until 90% confluence and stored in the liquid nitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1000U/ml ESGRO® recombinant mice leukemia inhibitory factor (LIF, Millipore, ESG1107, stock 107U/ml) and 2i (1μM PD325 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 20 ng/mL epidermal growth factor (EGF) (Upstate Biochem) and 100 ng/mL dexamethasone (Sigma). T47D cells were plated in 10 cm dishes at 20,000 cells/mL and maintained in McCoys 5A medium supplemented with 10% FBS and 10 μg/mL insulin ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies and the dilution factors were as follows: rabbit polyclonal anti-TH (ab152, Millipore) 1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 15% fetal calf serum (Hyclone) and Leukemia inhibitory factor (LIF) (1,000 units/ml, Millipore ESG1106). Cell medium was replaced daily ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies and their dilution factor are as following: Actin mouse (1:5000, Sigma-Aldrich A2228), beta-catenin rabbit (1:200 ...
-
Physiological activation of the nephron central command drives endogenous kidney tissue regenerationbioRxiv - Physiology 2021Quote: ... anti-growth differentiation factor 15 antibody (GDF15, 1:100, HPA011191, Sigma Aldrich, St. Louis, MO), anti-pappalysin2 antibody (PAPPA2 ...
-
bioRxiv - Neuroscience 2020Quote: ... including several transcription factors (anti-ATF3, 1:100, Abcam Ab207434; anti-SOX11, 1:500, Millipore ABN105 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1500 U/ml leukaemia inhibitory factor (LIF, Chemicon-Millipore, Billerica, MA, 107 U/ml). Cells were split every two days using trypsin (0.05% trypsin ...
-
bioRxiv - Microbiology 2022Quote: ... The dilution factor was ~15 for each round and the centrifugal concentrator (Merck Millipore Ltd.) had a molecular weight cut-off at 3 kDa ...
-
bioRxiv - Physiology 2024Quote: ... supplemented with 50 ng/ml mouse Nerve Growth Factor-7S (NGF, N 0513, Sigma-Aldrich), 10% horse serum and 50 µg/ml gentamicin ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... Neutrophils or differentiated CD34+ cells were primed with 1 µM platelet activating factor (Sigma-Aldrich) or dPBS vehicle ...
-
bioRxiv - Cell Biology 2023Quote: ... was used as a chemical analogue of the anabiosis factor (Sigma-Aldrich, St Louis, MO). Immediately before the experiment ...
-
bioRxiv - Cell Biology 2023Quote: ... whereas cell culture supplements and growth factors were purchased from Sigma (St. Louis, MO, USA). The antibodies against AFF3IR-ORF1 in mouse and against AFF3IR-ORF2 in rabbit were synthesized by GenScript (Piscataway ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml cholera toxin and 10 ng/ml epidermal growth factor (Merck Sigma-Aldrich). 4-Hydroxytamoxifen (4OHT ...
-
bioRxiv - Neuroscience 2020Quote: ... Dopamine signalling was manipulated by injecting the antagonist of D1 receptors SCH 23390 at a final estimated concentration of 1 μM (Sigma), the selective D2 receptor antagonist Sulpiride (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... For some experiments the AMPA/kainate glutamate receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 25 μM, Sigma-Aldrich), the NMDA glutamate receptor antagonist [3H]3-(2-carboxypiperazin-4-yl ...
-
bioRxiv - Neuroscience 2020Quote: ... Spontaneous IPSCs were isolated by blocking AMPA receptor-mediated events with CNQX (6-cyano-7-nitroquinoxaline-2,3-dione; 20uM; Sigma-Aldrich). Miniature events were isolated by blocking sodium channels with the addition of tetrodotoxin (1uM ...
-
bioRxiv - Neuroscience 2021Quote: ... were dissolved in magnesium-free HEPES-aCSF in the presence of non-NMDA glutamate receptor blockers (CNQX, Tocris, 0190, 40 μM; Nimodipine, Tocris, 0600, 1 μM; LY-367385, Sigma, L4420 ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... The role of mannose receptor was evaluated by incubating cells with HIV-1 in the presence of 100µg/mL BMA (Sigma-Aldrich) or 100µg/mL bovine serum albumin (BSA ...
-
bioRxiv - Neuroscience 2022Quote: Dopamine signalling was manipulated by injecting the antagonist of D1 receptors SCH 23390 at a final estimated concentration of 20 nM (Sigma). Finally ...
-
bioRxiv - Neuroscience 2022Quote: ... Dbh−/− mice were treated with either saline or the non-selective DA receptor antagonist flupenthixol (0.25 mg/kg) (Sigma-Aldrich) to determine if excessive DA signaling contributes to grooming in these mice.
-
bioRxiv - Neuroscience 2020Quote: ... Responsiveness to NGF was assayed by probing for the expression of tropomyosin receptor kinase A (Trk-A; 1:2000; #06-574, Millipore-Sigma) [48] ...
-
bioRxiv - Neuroscience 2019Quote: ... We then removed the supernatant and incubated the lysates on ice for 1 hour with rabbit antibody to D2 receptors (1 μg per 100 μL, Millipore). Anti-rabbit Ig IP beads were added and samples were incubated overnight at 4°C with gentle agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... The Flag-tagged receptor was detected using mouse anti-Flag M2 primary antibody (1:10,000 dilution; Sigma Aldrich, catalog #F3165) and IRDye® 680RD-conjugated donkey anti-mouse IgG secondary antibody (1:20,000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: The following odors/concentrations were used for comparing molecular properties to receptor responses: 1% 2-methyl-2-pentenal (Sigma 294667), 1% trans-cinnamaldehyde (Sigma C80687) ...
-
bioRxiv - Neuroscience 2021Quote: ... received bilateral infusions of either vehicle (aCSF; pH 7.4; males n = 5; females n = 4) or the GABAA receptor agonist muscimol (Sigma Aldrich, M1523 ...
-
bioRxiv - Neuroscience 2022Quote: ... Currents of 5-HT3A receptors and engineered constructs expressed at the cell surface were evoked by applying 10 μM serotonin creatinine sulfate complex (Sigma), or in short 5-HT ...
-
bioRxiv - Physiology 2023Quote: NIH-3T3-L1 cells were incubated in DMEM containing 2% fatty-acid free BSA in the presence of exogenous mitochondria and/or CL316,243 (β3-adrenergic receptor agonist; Sigma Aldrich) for 72 h ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and incubated with mouse primary anti-Collagen Type II (DSHB II-II6B3) or mouse anti-dopamine 4 receptor (MABN125, Millipore) primary for 2 h at room temperature in a humidified chamber ...
-
bioRxiv - Immunology 2024Quote: ... 8-Cyclopentyl-1,3-dipropylxanthine (DPCPX)(28, 33, 34) or A1 receptor agonist 2-Chloro-N6-cyclopentyladenosine (35) were purchased from Sigma Aldrich, dissolved in DMSO and filter sterilized by passing through a 0.22μm filter prior to use ...
-
bioRxiv - Neuroscience 2022Quote: ... The expression of the receptor was quantified at both molecular weight forms using anti-DRD1 primary (Sigma Aldrich, cat#D2944) at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... and was mixed with 1 µg total DNA (100 ng receptor plasmid + 200 ng mGs plasmid + 700 ng salmon sperm DNA (Sigma) solubilized in 100 µL OptiMEM ...
-
bioRxiv - Neuroscience 2023Quote: ... and the AMPA receptor inhibitor 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 µM, Sigma Aldrich, St Louis, MO, USA). This solution was applied to the autaptic culture neurons for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... of 33% DMSO in artificial cerebrospinal fluid (Veh) or the serotonin type 2a receptor antagonist M100907 (1μg/side; M3324, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... were dissolved in HEPES-aCSF in the presence of non-NMDA glutamate receptor blockers (CNQX, Tocris, 0190, 40 µM; Nimodipine, Tocris, 0600, 1 µM; LY-367385, Sigma, L4420 ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...