Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 4665 citations for SARS Coronavirus Spike Glycoprotein S1 Mosaic N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 0.15 mM 2-Mercaptoethanol (Millipore, Cat. No. ES-007-E), 100 U/ml Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... transferred to the Immobilon-P/E PVDF membrane (Merck Millipore), and immunodetected using the SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... followed by additional infiltration with 20 μM E-64d (Sigma) for an 8 h period ...
-
bioRxiv - Neuroscience 2020Quote: ... Pronase E (Protease from Streptomyces griseus Type XIV, Sigma Aldrich) was diluted in water to a concentration of 2 mg/mL ...
-
bioRxiv - Neuroscience 2020Quote: E-4031 (Alomone-Labs, IL) and TEA (Sigma-Aldrich, USA) were dissolved in 0.9% saline ...
-
bioRxiv - Immunology 2020Quote: ... E-64 and 3-Methyladenine (3-MA) were from Sigma. Necrostatin-1 was from Abcam ...
-
bioRxiv - Genomics 2022Quote: ... 0.15 mM 2-Mercaptoethanol (Millipore, Cat. No. ES-007-E), 100 U/ml Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Genomics 2022Quote: ... 0.15 mM 2-Mercaptoethanol (Millipore, Cat. No. ES-007-E), 100 U/ml Penicillin- Streptomycin (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were stained with hematoxylin and eosin (H&E, Sigma) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to Immobilon-E PVDF Transfer membrane (Sigma, IEVH85R). Blocked the membrane with 5% skimmed milk and incubated with primary antibody i.e. ...
-
bioRxiv - Molecular Biology 2022Quote: ... sectioned (3 μm sections) and stained with H&E (Sigma). LLC tumor samples and dorsal skin were embedded in 3.5- 4 % agar ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal anti-α E-catenin (C2081) was from Sigma. Rabbit polyclonal anti-phospho-Myosin Light Chain 2 (Thr18/Ser19 ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-human E-cadherin (EMD Millipore, DECMA-1) at a concentration of 1/200 in a humidified incubator overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... hNPCs were treated with 100 nM compound E (EMD Millipore) in Neural Medium for 48 hours and then maintained in Neural Medium supplemented with 20 ng/ml each of hBDNF and hGDNF for 3 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... Following resuspension in 50 ml/tube of E-MEM (Sigma), large cell aggregates were eliminated by filtering the cell suspension with a 60-μm stainless cell strainer (Ikemoto Scientific Technology) ...
-
bioRxiv - Biochemistry 2023Quote: ... William’s E Medium and hydrocortisone were purchased from Sigma Aldrich. Human insulin was purchased from pharmacy (Humulin N ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barium – gelatin mix (E-Z-EM Canada Inc; Sigma-Aldrich) was perfused until consistent pressure matching RVSP was obtained ...
-
bioRxiv - Bioengineering 2024Quote: Channel blockers E-4031 and nifedipine were purchased from Sigma, aliquoted in DMSO at a concentration of 10 mM ...
-
bioRxiv - Pathology 2024Quote: ... a 1% aqueous solution of eosin Y (Sigma E-6003) was prepared in deionized water and Harris Hematoxylin stain (Lerner Laboratories 1931382 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... D-Asp3-E-Dhb7-RR was purchased from Sigma Aldrich. Anabaenopeptin A and B ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Biophysics 2024Quote: ... 0.5 x EmbryoMax 2-Mercaptoethanol (Merck Millipore #ES-007-E), 2.5 μg/ml Plasmocin (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and SARS-CoV-2 was inactivated with 1% Triton-X (Sigma-Aldrich, Burlington, MA) in PBS for 1 hour ...
-
bioRxiv - Systems Biology 2020Quote: ... coli Rosetta (DE3) strain (Millipore Corporation, Billerica, MA, USA), as previously described40 ...
-
bioRxiv - Immunology 2021Quote: ... coli lipopolysaccharide (LPS) serotype O55:B5 at (Sigma-Aldrich) or for 4 h with 20 ng/ml recombinant mouse IL-4 (BD Pharmigen) ...
-
bioRxiv - Immunology 2019Quote: ... and transformed into Escherichia coli Rosetta (DE3) cells (Novagen). A single colony was inoculated into 2ml LB supplemented with Kanamycin at final concentration of 100µg/ml and incubated over night (O.N. ...
-
bioRxiv - Immunology 2021Quote: ... coli O55:B5 (2.5 mg/kg body weight; Sigma), as previously described (Huggins et al. ...
-
bioRxiv - Physiology 2019Quote: ... LPS (2μg, from Escherichia coli 055:B5, Sigma Aldrich) was administered intraperitoneally to mice that either had or had not previously received myocardial infarction surgery of the LAD ...
-
bioRxiv - Immunology 2019Quote: ... coli 055:B5 (10, 1, 0.1 µg/ml, SIGMA), anti-CD40 (10 µg/ml FGK4.5 ...
-
bioRxiv - Microbiology 2019Quote: ... coli strain BL21 (DE3) (Novagen, Merck Millipore, Darmstadt, Germany) carrying pET-AcGFP was grown in LB medium (1% tryptone ...
-
bioRxiv - Microbiology 2019Quote: ... coli strain BL21 (DE3) (Novagen, Merck Millipore, Darmstadt, Germany) carrying pET-AcGFP was grown in LB medium (1% tryptone ...
-
bioRxiv - Zoology 2020Quote: ... LPS (Escherichia coli 055:B5) was purchased from Sigma Chemical (St ...
-
bioRxiv - Bioengineering 2020Quote: ... LPS from Escherichia Coli 055:B5 ([L5418]; Sigma-Aldrich) was added to the hydrogel at a concentration of 36.6 EU/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... and transformed into Escherichia coli Rosetta2 (DE3) strains (Novagen). The transformed E ...
-
bioRxiv - Microbiology 2020Quote: ... coli using a Sigma GenElute Plasmid Kit (Sigma Aldrich). Yeast genomic DNA was isolated with the SDS/LiAc protocol [29] ...
-
bioRxiv - Microbiology 2020Quote: ... coli were grown in TSB (Tryptic soy broth, Sigma) and LB (Lysogeny broth ...
-
bioRxiv - Plant Biology 2021Quote: ... coli BL21 (DE3) for protein production (Novagen, Madison, USA).
-
bioRxiv - Microbiology 2020Quote: ... coli SIG10 electrocompetent cells (Sigma Aldrich, Saint Louis, ML) were used to clone plasmids using a combination of standard molecular cloning techniques and Gibson Assembly (master mix from New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... coli BL21 Rosetta 2 (DE3) pLysS strain (Novagen, #70956). The protein expression was induced with 0.5 mM IPTG and followed by culturing at 20 °C for 16 h ...
-
bioRxiv - Cell Biology 2021Quote: ... coli lysates using glutathione-agarose or -sepharose (Sigma; GenScript) and Talon metal affinity resin (Clontech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli B12 followed by glutathione-agarose affinity purification (Sigma). Purified protein was shipped for antibody production (custom polyclonal antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 1 mg/mL Escherichia coli transfer RNA (Sigma-Aldrich), 2 mM ribonucleoside vanadyl complexes (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were expressed in Escherichia coli Rosetta 2 (Novagen) in LB media ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli Rossetta DE3 cells (Millipore Sigma, Cat# 71400-3) and purified using MBP Agarose beads (Qiagen) ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21(DE3) or similarly efficient Rosetta cells (Novagen). For protein expression ...
-
bioRxiv - Biophysics 2019Quote: ... coli 70S Ribosome particles were purchased from Sigma-Aldrich, Trastuzimab and IgG1-RGY samples were provided by the team of Janine Schuurman at Genmab (Utrecht ...
-
bioRxiv - Bioengineering 2019Quote: ... coli expression and cloned into a pET28a(+) plasmid (Novagen) with an N-terminal hexahistidine-tag and C-terminal GSGRRRRRRRR sequence ...
-
bioRxiv - Microbiology 2020Quote: ... coli using a Sigma GenElute Plasmid Kit (Sigma Aldrich). Plasmids used in this study are shown in Table 4 ...
-
bioRxiv - Immunology 2021Quote: ... coli BL21 competent cells Champion21 and Rosetta2 (DE3) (Novagen), respectively ...
-
bioRxiv - Immunology 2020Quote: ... coli strain Rosetta-gami(DE3)pLysS (Novagen; Merck Biosciences). Following cell lysis with 10 µg/mL lysozyme and three freeze– thaw sonication cycles in 20 mM sodium phosphate (pH 7.8) ...