Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and the transcription elongation inhibitor 5,6-dichloro-1-ß-D-ribofurosylbenzimidazole (DRB; Sigma-Aldrich). The final concentrations of the drugs used were 0.4 aphidicolin ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-monoclonal anti-FLAG (Sigma-Aldrich; 1:1000), mouse-polyclonal anti-GAPDH (Millipore ...
-
bioRxiv - Plant Biology 2024Quote: The following inhibitors were dissolved in DMSO: Brefeldin A (Sigma); Cycloheximide (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... mounted in Chlorohydrate (Sigma number: 15307-500G-R) solution and analyzed using a Zeiss Axio Imager light microscope.
-
bioRxiv - Plant Biology 2024Quote: ... seedlings were incubated in liquid MS medium supplemented with 50 mM DTT (Sigma; dissolved in H2O) for 3 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... Lovastatin (Sigma); NPA (DUCHEFA N0926) ...
-
bioRxiv - Plant Biology 2024Quote: The plasmid pET28a (Novagen, San Diego, CA) was used to generate recombinant proteins fused in-frame with a Venus tag or a myc tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PXB mice were given irradiated PROLAB ISOPRO RMH 3000 feed and drinking water supplemented with L-Ascorbic acid (Cat # 25564, Sigma-Aldrich) at 0.3 mg/ml ...
-
bioRxiv - Plant Biology 2024Quote: ... Fenpropimorph (Sigma); Lovastatin (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... PAO (Sigma); Fenpropimorph (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... Auxin sensitivity was assessed by adding 100 μM IAA (Sigma) to the medium.
-
bioRxiv - Plant Biology 2024Quote: ... After two-to-three days bacteria were resuspended in ddH2O containing 0.04% Silwet L77 (Sigma Aldrich, USA). The bacterial suspension was adjusted to an OD600 = 0.2 (108 cfu/mL ...
-
bioRxiv - Plant Biology 2024Quote: ... USA) and all other chemicals from Sigma-Aldrich (St. Louis, MO, USA).
-
bioRxiv - Plant Biology 2024Quote: ... 150 mM NaCl and further concentrated using Amicon Ultra concentrators from Millipore (Merck, Germany) with a 30,000 Da molecular weight cut-off ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng/mL IL-4 (Sigma), and 0.5 ug/mL anti-CD180 (BD Pharmingen ...
-
bioRxiv - Cell Biology 2024Quote: ... Control conditions included a set of micropattterned grids that were not incubated in antibody (No Ab) and another set of micropatterned grids that were treated with monoclonal antibodies to VZV glyco-protein E (gE; EMD Millipore Cat# MAB8612).
-
bioRxiv - Cancer Biology 2024Quote: Drug and proliferation assays were done using the Cell Proliferation MTT Kit (Sigma) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Sample buffer (0.1875 mM Tris-HCl (Sigma-Aldrich, #T4661) pH 6.8 ...
-
bioRxiv - Cell Biology 2024Quote: ... + 5% (w/v) crystal violet (Sigma-Aldrich #C0775) in water ...
-
bioRxiv - Cancer Biology 2024Quote: ... and activated with 25 ug/mL LPS (Sigma), 5 ng/mL IL-4 (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (Sigma-Aldrich #D9542) was added at the same time as the secondary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: ... and fixed with 3% (w/v) PFA (Sigma-Aldrich #158127) in PBS pH 7.4 at room temperature for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Unreacted PFA was quenched by washing with 50 mM NH4Cl (Sigma-Aldrich #213330) in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... incubated in poly-l-lysine (PLL, Sigma cat # p4707), incubated in mPEG-Succinimidyl Valerate ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by permeabilization with 0.2% (v/v) TritonTM X-100 (Sigma-Aldrich #X100) in PBS at room temperature for 5-10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.05% (w/v) bromophenol blue (Sigma-Aldrich #B5525), and 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... blots were blocked in 5% (w/v) milk powder in PBS (PanReac AppliChem #A0965,9100)-TWEEN® 20 (Sigma-Aldrich #P1379) (PBS-T) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% (w/v) SDS (Sigma-Aldrich #75746), 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... before mounting onto glass microscopy slides with Mowiol® 4-88 (Sigma-Aldrich #81381). Samples were imaged on a standard upright microscope system (BX61 ...
-
bioRxiv - Cell Biology 2024Quote: ... 10% (v/v) glycerol (Sigma-Aldrich #G9012), 0.05% (w/v ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10% (v/v) β-mercaptoethanol (Sigma-Aldrich #M3148) in water ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CFA (Sigma) was diluted 1:1 with saline and vortexed for 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1% Tween 80 (Sigma Aldrich). The 2 month and 5 month acute studies used GL-II-73 at 5mg/kg and 10mg/kg in the Y maze via IP injection ...
-
bioRxiv - Cancer Biology 2024Quote: ... and test compounds (BKIDC-1553-N-Me or 3-bromopyruvate (Sigma-Aldrich, Cat# 16490) using DMSO as a vehicle control) ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were incubated at 37 °C for 6 hr to allow adhesion and spreading onto a cell culture plate before the addition of 15 μM NCT503 (#19718, Cayman) or 10 μM WQ2101 (#SML1970, Millipore Sigma). After 48-hr treatment with the drug ...
-
bioRxiv - Cancer Biology 2024Quote: ... SIRT2 (#09-843, Millipore Sigma), MCT1 (#20139-1-AP ...
-
bioRxiv - Cancer Biology 2024Quote: ... hexokinase activity was measured using Hexokinase Colorimetric Assay Kit (Sigma-Aldrich, Cat# MAK091) on 96-well plates according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 from Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the following secondary antibodies conjugated to HRP (horseradish peroxidase): goat anti-rabbit (EMD Millipore #12–348) and goat anti-mouse (EMD Millipore #AP181P) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50 µM ∂-thioglycerol (Sigma-Aldrich, M-6145), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed with PBS and lysed in ice-cold RIPA buffer containing a protease inhibitor cocktail (Sigma-Aldrich, P8340) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Cancer Biology 2024Quote: ... culture media was collected and filtered with Amicon Ultra-0.5 centrifugal filter devices (#UFC500396, Millipore Sigma), and then diluted with PBS (1:300 ratio) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 60%(w/v) aqueous 30% (w/v) (2-Hydroxypropyl)-β-cyclodextrin (#H5784, Millipore Sigma). 40 mg/kg NCT503 was injected intraperitoneally ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 11 mM [U-13C] glucose (#389374, Millipore Sigma). After 6-hr incubation ...
-
bioRxiv - Cancer Biology 2024Quote: ... gels in TAE buffer (40 mM Tris Acetate, 1 mM EDTA pH 8.0) containing ethidium bromide (0.2 mg/mL, Sigma) and imaged on GelDoc DOCTM XR+ Gel Documentation system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... (Supplementary Table 2) were obtained from the Merck CRISPR glycerol stock arrayed mouse sgRNA library available at WEHI ( Sigma Aldrich #MSANGERG).
-
bioRxiv - Cancer Biology 2024Quote: ... were coated overnight with retronectin solution (32 µg/mL in PBS, WEHI) at 4℃ followed by blocking with 2% bovine serum albumin solution (Sigma-Aldrich, #A1595) in PBS at 37℃ for 30 min prior to coating with viral supernatant ...
-
bioRxiv - Cell Biology 2024Quote: ... clone 6-11B-1 (1:1,000 IF, 1:10,000 WB, Sigma-Aldrich T6793; RRID:AB_477585); mouse IgG2a anti-GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... NCT503 solution (#SML1659, Millipore Sigma) was prepared in a 5% (w/v ...