Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 2842 citations for 6 Methoxyquinazoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Then cells were stained with a 1/15000 dilution of 4’,6-diamidino-2-phenylindole (DAPI) (Sigma) and mounted in antifading agent Citifluor AF1 (Citifluor Ltd.) ...
-
bioRxiv - Bioengineering 2020Quote: ... as-synthesized mesoporous silica nanoparticles (AMS-6) were loaded with 20% Dox (Doxorubicin hydrochloride, #D1515, Sigma-Aldrich). Dox diluted in 100% ethanol was added to AMS-6 nanoparticles in a round bottom flask mounted on a rotary evaporator ...
-
bioRxiv - Bioengineering 2020Quote: ... the glass fiber capture membrane was submerged for 6-8 hours in trifluoroacetic acid (TFA, Sigma-Aldrich), and dried at room temperature overnight before assembly ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6-7-week-old female mice were injected intraperitoneally with 1 mg of Tamoxifen (T5648, Sigma-Aldrich) on three consecutive days ...
-
bioRxiv - Bioengineering 2020Quote: ... FMN was added in excess (above its solubility limit) (F6750, Sigma-Aldrich: 70% pure, free RbF ≤ 6%) and samples were incubated on ice for at least 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... and zanamivir ((2R,3R,4S)-3-acetamido-4-(diaminomethylideneamino)-2-[(1R,2R)-1,2,3-trihydroxypropyl]-3,4-dihydro-2H-pyran-6-carboxylic acid) were purchased from Sigma, NN-DNJ from Toronto Biochemicals ...
-
bioRxiv - Pathology 2020Quote: ... We used primary mouse monoclonal antibodies against anti-α-acetylated tubulin (clone 6-11B-1, Sigma Aldrich and proliferating cell nuclear antigen (PCNA ...
-
bioRxiv - Microbiology 2021Quote: ... A549 (ATCC) or HeLa (ATCC) cells were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Trichloroethylene (CAS Number 79-01-6) and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted ...
-
bioRxiv - Neuroscience 2020Quote: ... Hamilton syringes with 33 gauge needles were used to deliver 2 µL of 6-OHDA (Sigma-Aldrich, France ...
-
bioRxiv - Neuroscience 2019Quote: Samples were incubated in a blocking solution of 10% DMSO/6% donkey serum (EMD Millipore, Temecula, CA)/0.2% Triton X-100/PBS at 37 °C for 2-3 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... They were then washed and permeabilized 6 x 5mins in PBSTx (PBS plus 0.5% Triton-X (Sigma)) and blocked for 2 hrs room temperature in PBSTx plus 5% goat serum (Sigma) ...
-
bioRxiv - Physiology 2019Quote: ... Nuclei were identified using 4′,6-diamidino-2-phenylindole (DAPI, 1□μg/ml, Sigma Aldrich, Dorset UK). SDH staining was performed as previously described (Smith et al. ...
-
bioRxiv - Immunology 2019Quote: ... then washed with 1% BSA/PBS and stained with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) for 10 min at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... vibratome sections (500 µm) from wild-type (C57BL/6) lungs were stained with rabbit anti-SftpC (Millipore) and Armenian hamster anti-Muc1 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... UFM1 (GCTGTGAAAGGTGTACTTTC) and UFC1 (GTGACAACGATTGGTTCCGAC) followed by selection with 75 µg/ml 6-thioguanine (Sigma-Aldrich, A4882) 4 days after electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell nuclei were stained with DAPI (1:1000, 4’ s-6-diamidino-2-phenylindole, Sigma Aldrich, USA) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 6-day-old perithecia with TRI Reagent (Sigma-Aldrich, cat. no. T9424) and re-suspended in 5M urea ...
-
bioRxiv - Immunology 2020Quote: ... T cells were also stimulated for 6 hours with 50ng/ml PMA and 1μg/ml Ionomycin (Sigma). T cells were then harvested ...
-
bioRxiv - Molecular Biology 2021Quote: Melanoma cells treated with ARN22089 for 6 or 24 h and lysed in RIPA buffer (EMD Millipore or an optimized cocktail (250 mM NaCL ...
-
bioRxiv - Microbiology 2021Quote: ... approximately 3 to 6 L of diffuse flow fluid were pumped through 0.22 μm Sterivex filters (Millipore). Shipboard ...
-
bioRxiv - Developmental Biology 2021Quote: Adult fish (between 3-6 mpf) were anesthetized by immersion into 0.04% tricaine (Sigma, St Louis, MO) and the AF were carefully detached using surgical blade and forceps ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the embryos were treated for 6 days with 0.003% N-phenylthiourea (PTU) (Sigma, St Louis, MO) to inhibit pigment formation.
-
bioRxiv - Genetics 2020Quote: ... HUT 78 cells were treated up to 6 hours with 1 μM of romidepsin (Sigma-Aldrich, SML1175), DMSO being used as a control ...
-
bioRxiv - Genetics 2020Quote: ... cells were permeablised first with 1ml/well (6-well plate) mTESR1 medium with 8μg/ml polybrene (Millipore) for 15 min (37°C) ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 g (±5 g) female C57BL/6 mice were injected intraperitoneally (I.P) with LPS (L-5886, Sigma). EVs were I.V injected via the tail vein subsequent to LPS induction and the animals were observed and weighed daily after induction ...
-
bioRxiv - Microbiology 2020Quote: ... 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2022Quote: ... and digested in 6 ml of 2-mg/mL type II collagenase (Sigma # C6885 or Worthington #LS004177) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 μg TRC2-pLKO-puro vector encoding shRNA (TRCN0000377256-NM_005871.3-637s21c1, designated here as shSMNDC1-6, or TRCN0000369078-NM_005871.3-724s21c1, designated here as shSMNDC1-7, Sigma) targeting different sequences of SMNDC1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Successfully transduced cells were then selected using blasticidin (6 µg/ml, Cat. no. 15205, Sigma-Al- drich). For the experiments ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were stained using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma Aldrich-Aldrich, Catalog No-D9542).
-
bioRxiv - Cell Biology 2022Quote: ... fibroblasts were seeded at 2.25×104 into each well of 6 well dishes (Millipore Sigma Cat. CLS3516) in 2ml complete M106 on Day 0 and grown overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of RNA replicons were transfected into 105 fibroblasts on 6-well plates using RiboJuice (Sigma) in the presence of 100 ng/ml B18R (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Adult mice (7 week old) mice were injected with 6 mg of Tamoxifen in Corn Oil (Sigma) intraperitoneally for 3 days ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with DAPI (4’,6-diamidino-2-phenylindole) (0.1 ng/μL, Sigma-Aldrich, cat. # D9542) for 5 min to exclude dead cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1x in wash buffer containing 0.1 μg/ml 4′,6-Diamidino-2-phenylindole dihydrochloride (Millipore Sigma, D8417), and 1x in wash buffer for 5 min each ...
-
bioRxiv - Genetics 2022Quote: ... UMOD-GFP cells were treated for 6 h with 2.5 μM proteasome inhibitor MG132 (M8699, Sigma-Aldrich). Protein samples were collected at 2 ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... the barcode beads were washed three times in 6 x SSC buffer (Sigma, catalog no. S0902-1L) and loaded into Countess (Thermo-Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with the nuclear dye 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, Germany) and actin filaments were labeled with ATTO 647-phalloidin conjugate (Hypermol EK ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 weeks aged mice were fed with drinking water containing 50 μg/mL 4NQO (Sigma-Aldrich, N8141) for 16 weeks and then given normal drinking water for additional 10 weeks ...
-
bioRxiv - Neuroscience 2023Quote: ... confluent wells in a 6-well plate were incubated with 20mM NH4Cl (Sigma-Aldrich, St Louis MO) and 300μM leupeptin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-8 weeks-old mice were intraperitoneally injected with 0.1mL of 10mg/mL 4-hydroxytamoxifen (Sigma Aldrich) dissolved in a solution of DMSO ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-week- old male mice were injected with 25 mg/kg LPS (Sigma Aldrich, St. Louis, MO) or PBS above calvariae ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All medium for microfluidic experiments contained 20mg/L Pluronic F127 surfactant (CAS 9003-11-6, Sigma-Aldrich).
-
bioRxiv - Systems Biology 2022Quote: ... Shapes were then re-suspended in 6 μL of 80 mM triethylammonium bicarbonate buffer (pH 8.5, Sigma) with 0.013% dodecyl-β-D-maltoside (DDM ...
-
bioRxiv - Cell Biology 2023Quote: ... at density .5×106 cells / 6-well plate coated with gelatin (Millipore, cat. no. ES-006-B). Cells were cultured in basic culture media (described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then 0.2 mL of washed IgG Sepharose 6 Fast Flow beads (Millipore Sigma, Cat#: GE17-0969-01) were added to each sample and incubated on a rotisserie mixer for 0.5 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...