Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 10000+ citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg/ml Hoechst 33258 (Sigma) was added for 10 min before mounting with ProLong™ Glass Antifade Mountant (Thermo Fisher).
-
bioRxiv - Cancer Biology 2024Quote: ... or 5-Azacytidine (AZA, Sigma Aldrich) were added at the start of the cultures (day 0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μg/ml insulin (Sigma-Aldrich) and 1% L-glutamine (Euroclone) ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg/kg LPS (Sigma-Aldrich) were injected intraperitoneally 75 min prior to sacrifice ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 nitroisatoic anhydride (5NIA, Millipore Sigma) was prepared at in DMSO immediately before probing ...
-
bioRxiv - Bioengineering 2024Quote: ... and insulin (5 µg/mL; Sigma) at 37 °C and 5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng/mL IL-4 (Sigma), and 0.5 ug/mL anti-CD180 (BD Pharmingen ...
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5-triphenyltetrazolium chloride (Millipore Sigma T8877) in PBS for 30 minutes at 37⁰C and then washed in 4% PFA in PBS for 24 hours at 4⁰C ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ug/mL NAC (Sigma # A8199), 5 ug/mL insulin (Sigma #11882) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM LiCl (Sigma-Aldrich, L4408), 1 mM nicotinamide (NAM ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and 5 µM cytosine arabinoside (Sigma) was also added to suppress glial proliferation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Tert-Butylhydroquinone (tBHQ; 0, 0.5-30 μM; 112941, Sigma-Aldrich, St Louis, USA), a well-known Nrf2 activator ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2,6-Di-tert-butyl-4-methylphenol (BHT) were purchased from Millipore sigma. Squalene was purchased from ThermoFisher Scientific and BIBB 515 was purchased from Cayman Chemical.
-
bioRxiv - Cancer Biology 2020Quote: ... total cellular lipids were extracted with methyl tert-butyl ether (MTBE) (Sigma Aldrich) from fresh cell pellets and dried in a SpeedVac concentrator (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 4.0 mL of methyl-tert-butyl ether (MTBE, EMD Millipore, Billerica, MA) in a 13 x 100 mm glass screw-top tube ...
-
bioRxiv - Neuroscience 2022Quote: ... the cells were treated with various concentrations of tert-Butyl Hydroperoxide (tBHP) (Sigma). On Day 3 ...
-
bioRxiv - Microbiology 2022Quote: ... combined with 2 μL N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA, Sigma-Aldrich #394882) in a GC auto-sampler vial with a 200 μL glass insert ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further derivatized with 10 μL tert-butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma, 394882) and incubating at 70°C for 60 minutes.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Physiology 2022Quote: ... Membranes were blocked for 1 hour at room temperature in 5% milk or 5% BSA (Millipore Sigma) in 1X Tris-buffered saline + 0.1% Tween 20 (TBST) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Biochemistry 2019Quote: Clindamycin [CAS: 21462-39-5] and 5-fluorouracil [CAS: 51-21-8] were purchased from Sigma-Aldrich, St ...
-
bioRxiv - Cancer Biology 2021Quote: T-HEp3 cells (P1) growing in a dish were treated with 5 nM 5-Azacytidine (Sigma #A2385) in DMEM containing charcoal-stripped 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM β-mercaptoethanol and incubated for 5 min with 2 mM ATPγS (lithium salt, Sigma Aldrich). 4 µL of this mixture were then applied to the plasma-cleaned grids ...
-
bioRxiv - Neuroscience 2020Quote: ... Trim28-fl(+/− and +/+) animals (Ctl n=5, KO n=5) were put in RIPA buffer (Sigma-Aldrich) containing Protease inhibitor cocktail (PIC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Selected sections were incubated with 5 mg/ml α-amylase for 5 minutes at 37 °C (Sigma) to confirm distinct glycogen and glycoprotein stain localization ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Evolutionary Biology 2020Quote: ... guanosine-15N5 5′-monophosphate (Cat #900380) and guanosine-13C10 5′-triphosphate (Cat #710687) were purchased from Sigma-Adrich (St ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA) (Sigma-Aldrich) for phosphorylated proteins immunoblots in Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Genetics 2022Quote: ... The membrane was hybridized with 5 pmol/ml of a 5’ DIG-labeled (AGAGGG)10 probe (Sigma) in DIG Easy Hybridization Solution (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... one cells have adhered remove culture medium and replace with diluted lentiviral media (500µl lentiviral media, 1.5ml DMEM, 10% FCS, 5% PenStrep, 5-10µg Polybrene (Sigma)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% LPDS: DMEM containing 1x PenStrep and supplemented with 5% (v/v) LPDS (Sigma Aldrich, USA, S5394).
-
bioRxiv - Molecular Biology 2021Quote: ... 5% Glycerol) supplemented with 1 mM Phenylmethylsulfonyl fluoride (Carl Roth) and 5 mM β-Mercaptoethanol (Sigma Aldrich). The resuspended cells were disrupted by sonication with a Branson Digital Sonifier (Model 102C ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were blocked in PBS 1X containing 5% Normal Horse Serum and 5% bovine albumin (Sigma-Aldrich) for 1h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The 5 µl samples were injected onto a ZIC-pHILIC column (150 mm × 2.1 mm; i.d. 5 µm) with a guard column (20 mm × 2.1 mm; i.d. 5 µm) (Millipore) for LC separation ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×104 human MDMs or murine (NSG) BMDMs were co-cultured with 5×104 PKH26-labeled (Sigma) tumor cells in the presence of the different recombinant SiRPα decoys at 10ug/ml in serum-free medium in 96-well ultra-low adherent plates (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... 5×104 human MDMs or murine (NSG) BMDMs were co-cultured with 5×104 PKH26-labeled (Sigma) tumor cells in serum-free medium in 96-well ultra-low adherent plates (Corning ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked using 5% non-fat dry milk or 5% bovine serum albumin (BSA) (Sigma-Aldrich) in Tris-buffered saline (TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... in PBS) was combined with 5 µL of 5% N,N,N’,N’-tetramethylethylenediamine (TEMED) (Sigma, T9281) and 5 µL of 5% ammonium persulfate (APS ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 µL of the supernatant were either mixed to 5 µL of trehalase (Sigma T8778-1UN) diluted in trehalase buffer (described above ...
-
bioRxiv - Neuroscience 2024Quote: ... Rapamycin was diluted in 5% polyethylene glycol-400 (PEG400, Fluka) and 5% Tween®80 (Sigma-Aldrich) in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... After destaining, the blots were blocked with 5% skim milk (Himedia, #M530) or 5% BSA (Sigma, #A7906) for Phospho-proteins for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... Each strain was grown overnight in GMM (20 mM glucose, 5 mL culture tubes) supplemented with 1x MEM amino acids (AA) (Sigma, Cat. No. M5550). Cells were pelleted ...
-
bioRxiv - Plant Biology 2022Quote: ... normalizing protein levels to the Rubisco large subunit visualized in membranes stained with Ponceau (0.1 % Ponceau S Sigma-Aldrich in 5 % acetic acid). The statistical differences between the average protein levels of each sample were inferred using a Student’s t-test.