Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... (2) from Millipore-Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... 2’-bipyridyl (Sigma) to deplete residual iron ...
-
bioRxiv - Pathology 2024Quote: ... (2) from Millipore-Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% DABCO (Sigma). Imaging was performed on an LSM 980 Confocal Microscope with a 63X Plan Apochromat N.A ...
-
bioRxiv - Neuroscience 2024Quote: ... biocytin (Sigma; 2%) was added to evaluate morphology ...
-
bioRxiv - Microbiology 2021Quote: ... Chromatin immuno-precipitation was carried out using 2 µL of a commercially available anti-RNA polymerase II subunit B1 phospho-CTD Ser-5 antibody (Millipore, clone 3E8, cat. no. 04-1572) for RNAP II ...
-
bioRxiv - Immunology 2020Quote: ... Creatine (Sangon Biotech cat. A600326, 10 mg/ml), L-Citrulline (Sangon Biotech cat. A604057, 5 mg/ml) and Spermidine (Sigma-Aldrich cat. S0266, 2 mg/ml) were added to the drinking water 7 days prior to the IMQ application and the treatment lasted until the end of model establishment ...
-
bioRxiv - Neuroscience 2021Quote: ... A 2 by 2 mm piece of gelfoam that had pre-absorbed 5 μl of chondroitinase ABC (ChABC, from Proteus vulgaris, Sigma C3667, diluted at 50 U/ml) or of saline solution (control birds ...
-
bioRxiv - Genomics 2023Quote: ... undifferentiated iPSC colonies were treated with 5 μM of the Y27632 compound and dissociated to single cells with Accutase (Millipore, 1:2 dilution in PBS 1X). Four million dissociated cells were seeded in each well of a 6-well plate and cultured in mTeRS1 with 10 μM Y27632 compound on an orbital shaker at a speed of 95 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary human lung fibroblasts of passage 5 until 7 (table 2) or CCL206 fibroblasts were proliferation-inactivated with mitomycin C (10 μg/ml, Sigma-Aldrich, St. Louis, MO, USA, #M4287) for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... FAIK3-5 were treated with 1 µM of the hypomethylating agent 5-Azacytidine (5-Aza, Sigma-Aldrich, St. Louis, MO, United States) in an additional approach ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipids were separated using a solvent mixture of triethylamine/chloroform/ethanol/water (5:5:5:1, v/v) (all solvents HPLC grade, Sigma-Aldrich, USA) as mobile phase in a solvent vapour saturated twin trough chamber (CAMAG ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1% w/v of 2-Hydroxy-4’-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure D-2959) photoinitiator (Sigma-Aldrich) in phosphate buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human interleukin-2 (IL-2) (H7041) was purchased from Sigma Aldrich. Ficoll-PaqueTM PLUS (17-1440-02 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) hexafluorophosphate azabenzotriazole tetramethyl uronium (HATU; 2 equiv:ELP amine, Sigma, 445460), and (3 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM penicillin/streptomycin and 2 mM L-glutamine (Sigma, UK). Hek-293T cells were plated in 24 well plates for 24 hours before transduction with LV-LTα or LV-GFP at MOI 5 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μM ponatinib (Selleckchem) or 2 μM iodoacetamide (IAA) (Sigma-Aldrich), the other half was treated with vehicle (DMSO or water ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg/mL 4′,6-Diamidin-2-phenylindol (DAPI, Sigma-Aldrich) in 1X PBS was added for 2 min followed by a final washing step ...
-
bioRxiv - Microbiology 2020Quote: ... 2% glycerol or 2% casamino acids and in RPMI-1640 (Sigma, containing L-glutamine ...
-
bioRxiv - Microbiology 2022Quote: ... E2 and P4 were solubilized in 2-butanol (2-BtOH; Sigma) as our previous studies demonstrate that this reagent does not interfere with NgPLD activity ...
-
bioRxiv - Bioengineering 2020Quote: ... The photoinitiator (2-hydroxy-2-methylpropiophenone, Darocur 1173, 405655, Sigma-Aldrich) is introduced with the two precursors.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 25mM Hepes (N-[2-hydroxyethyl]piperazine-N0-[2-ethanesulfonic acid; Sigma]), supplemented with 10% heat inactivated FBS (GIBCO ...
-
bioRxiv - Immunology 2020Quote: 2-deoxy-d-glucose (2-DG; Sigma-Aldrich, St. Louis, MO) treatment of wounded zebrafish larvae (simple tail transection ...
-
bioRxiv - Immunology 2022Quote: ... followed by clearing/mounting using 2’-2’-thio-diethanol (Sigma, 166782) as previously described6 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mm samples were embedded instead in 2% agarose (Sigma-Aldrich) in 0.15 M CaC or in water (depending on the last staining step that the sample was exposed to ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 mM N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (Sigma H0887), 100 U/ml penicillin and 100 μg/ml streptomycin (Sigma P4333 ...
-
bioRxiv - Cell Biology 2024Quote: ... and drugs (2-deoxy-d-glucose (2-DG, SIGMA, 1 mM), N-acetylcysteine (NAC ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 μM ISG65 or 2 μM bovine serum albumin (Sigma) were combined in phosphate buffered saline pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mM potassium hexacyanoferrate(II) trihydrate (C6FeK3N6+2 · 3H2O; Sigma Aldrich), 2 mM potassium hexacyanoferrate(III ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 2-Deoxy-D-Glucose (2-DG; D8375; Sigma; 10 mM), as stated.
-
bioRxiv - Neuroscience 2022Quote: 2-Bromopalmitate (or 2-bromohexadecanoic acid, Sigma-Aldrich, Cat no. 238422) was dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2022Quote: ... 2% pectone (Difco) and 2% glucose (Sigma-Aldrich, Carlsbad, CA, USA) or selective medium YNB containing ...
-
bioRxiv - Synthetic Biology 2022Quote: ... was mixed with photo-initiator 2-hydroxy-2-methylpropio-phenone (Sigma) (90/10% w/w) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline and 2 µM Ara-C (Sigma-Aldrich). From day 3 – 6 ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2% FBS and 2% antibiotic antimycotic solution (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2024Quote: ... and 2-deoxy-D-glucose (2-DG) (50 mM) (Sigma Aldrich). When stated ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM 6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Sigma, 238813), 250 µg/ml glucose oxidase (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... plus 20 μl 2-mercaptoethanol (Sigma cat. no. 60-24-2) then frozen at – 80C.
-
bioRxiv - Cell Biology 2024Quote: ... 0.1 M 2-Deoxy-Glucose (2-DG; Sigma Aldrich #D8375-1G)37 ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’-GACCAGAGACG TGTAGCAATG-3’, Reverse: 5’-ACAATGCTTTGACGATGCCATA-3’) and ACTB (Forward: 5’-CTGGAACGGT GAAGGTGACA-3’, Reverse: 5’-AAGGGACTTCCTGTAACAATGCA-3’) were ordered from Sigma Aldrich (Missouri, USA). cDNA synthesis was carried out using the QuantiTect Reverse Transcriptase Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.