Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 10000+ citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... Linoleic Acid (EIC) (Sigma-Aldrich, L1376, CAS number: 60-33-3) were prepared immediately prior to use from DMSO stocks (100 mM) ...
-
bioRxiv - Microbiology 2024Quote: ... Standard solutions were prepared using poly (3-hydroxybutyric acid) (SIGMA Aldrich) and mcl-PHAs from Pseudomonas putida KT2440 ...
-
bioRxiv - Cell Biology 2024Quote: ... were saturated with 3% fatty acid free BSA (Sigma-Aldrich A8806) in PBS-Tween-20 0.1% for 1 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 8% polyacrylamide gel containing 0.5% 3- (Acrylamido) phenylboronic acid (Sigma-Aldrich) after resuspending in a 2X RNA Loading Dye (NEB) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MS 222 (3-aminobenzoic acid ethyl ester methane sulfonate, Sigma, Germany) was used to anesthetize all specimens ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) was added to media to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cell Biology 2024Quote: ... auxin (3-indoleacetic acid, Sigma 13750, 2 M stock in DMSO) was added to one subculture for a final concentration of 2 mM ...
-
bioRxiv - Immunology 2023Quote: ... Cells were incubated on ice for 3 min and 2 mL wash buffer (10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 0.1 % Tween-20, 1 % BSA, 1 mM DTT, 1 U/µL Sigma Protector RNase inhibitor in nuclease free water ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2.5 µM of 4-(4-Diethylaminostyryl-1-methyl-pyridinium-iodid (DiAsp, Sigma, D3418), which specifically labels hair cells in the lateral line in 0.5 % DMSO for 30 minutes35 ...
-
bioRxiv - Genomics 2023Quote: ... followed by the addition of 1 uM 4-Hydroxytamoxifen (4-OHT; Sigma, SML1666), when required ...
-
bioRxiv - Pathology 2020Quote: ... 5-azacytidine (5-aza, Sigma-Aldrich; 1 µM in 10% FCS DMEM) for 7 days according to previous publications12 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mL of freshly prepared 5 mg mL−1 Clostridium histolyticum collagenase (Sigma) in Tris calcium buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse α-Tubulin (Sigma, B-5-1-2, # T5168, used at 1:5000), mouse α-FLAG (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α tubulin (T5168, B-5-1-2, Sigma-Aldrich, 1:1000). Rabbit anti-Solo antibody was purified using an immunogen peptide conjugated-Sepharose column from the antiserum ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg of pSC2G-CFTR23 plasmid was co-transfected with 1 μM single-stranded DNA repair template (synthesized by Sigma, Table 3) comprising the CFTR-W1282X and silent protospacer adjacent motif (PAM ...
-
bioRxiv - Cell Biology 2020Quote: ... The liver tissue was cut into 3-4 mm pieces and incubated with 1 mM EGTA (Sigma-Aldrich, Cat. no. E0396-10G) in 1 x DBPS (Gibco™ ...
-
bioRxiv - Neuroscience 2020Quote: A stock solution (74.8 mM) of the MEK inhibitor 2-(2-amino-3-methoxyphenyl)-4H-1-benzopyran-4-one (PD98059, PD hereafter, Sigma-Aldrich, Argentina) was conserved at −20 °C and freshly diluted in DMSO to the desired concentration (11.22 mM ...
-
bioRxiv - Microbiology 2023Quote: ... COMMD2 immunoblots were blocked for 1 hr at room temperature in 3% milk TBST and probed overnight at 4°C with the primary antibody (Sigma ref# HPA044190) suspended in 3% milk TBST ...
-
bioRxiv - Genomics 2024Quote: ... Samples were stained with 1xTBS with 0.1% (v/v) Tween-20 and 3 mg/mL PVSA with 2ug/mL 4’,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542) for 5-10 minutes at room temperature manually and rinsed three times with 1xTBS with 0.1% (v/v ...
-
bioRxiv - Genomics 2024Quote: ... formamide in 1xTBS with 0.1% (v/v) Tween-20 and 3 mg/mL PVSA with 2ug/mL 4’,6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542). Readout probes ...
-
bioRxiv - Neuroscience 2022Quote: ... SIGMA, #M9942, 1:200), (ki67, BD Pharmingen, #550609, 1:200), (C-caspase 3, Cell-signaling, #9661S, 1:100) (PCNT, SIGMA, #HPA016820, 1:200), (P-Histone H3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... On the 7th day 1 µM Senexin B (SenB, Senex Biotechnology, Columbia, SC) or 1 µM 4-hydroxytamoxifen (4-OHT, Sigma-Aldrich) was added to the cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrates (Sigma-Aldrich) in NTM (100mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and the blotting signals were chemically visualized with either the nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP) chromogenic assay (Sigma) or infrared scanner ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... coli DH5α cells were transformed with the resulting pho-lac fusion plasmids and streaked on dual indicator plates containing LB agar with 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) (Sigma) at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal ...
-
bioRxiv - Microbiology 2021Quote: ... Immunoreactive bands were detected by the addition of BCIP (5-bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium solution (Sigma-Aldrich). The reaction was stopped after 2 min by washing the blots with large volumes of deionized water.
-
bioRxiv - Bioengineering 2021Quote: ... slides were either treated with SIGMA FAST™ BCIP/NBT (5-Bromo-4-chloro-3-indolulphosphate/Nitro blue tetrazolium, pH 9.5, Sigma) and counterstained with nuclear fast red (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... after 72 hours of drug treatment, 20μl of a 5mg/mL 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (M2128-MTT; Sigma-Aldrich, USA) solution was added to each of the wells ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: Cytotoxicity of Quercetin and other natural compounds was evaluated using MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). Following the drug treatment in triplicate at indicated concentrations ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated in NBT (nitro-tetrazolium blue)-BCIP (5 bromo-4-chloro-3’-indolyphosphate p-toluidine) (Sigma-Aldrich), 0.033% in APTMg in dark condition ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were cultivated under humidified conditions with 5% CO2 at 37°C and passaged every 3-4 days using 0.05% trypsin/EDTA (Sigma-Aldrich). Cells were harvested in ice-cold PBS buffer using a cell scraper ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Cell Biology 2024Quote: ... Auxin-inducible degradation of proteins was induced by treatment with 0.5 mM indole-3-acetic acid (IAA) (Sigma, I2886-5G, CAS: 87-51-4) and 4 µM phytic acid dipotassium salt (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: Auxin-inducible degradation of proteins was induced by treatment with 0.5 mM indole-3-acetic acid (IAA) (Sigma, I2886-5G, CAS: 87-51-4) and 4 μM phytic acid dipotassium salt (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... followed by 5 min in 5% phosphotungstic/phosphomolybdic acid solution for 5 min (Sigma HT152 and HT153 respectively). Slides were rinsed in diH2O then stained for 4 min in Aniline Blue solution ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% tannic acid and 1% uranyl acetate prior to graded ethanol dehydration and Hexamethyldisilazane substitution (HMDS, Sigma-Aldrich). Dried samples were then rotary-shadowed with 2 nm of platinum and 5-8 nm of carbon using an ACE600 high vacuum metal coater (Leica Microsystems) ...
-
bioRxiv - Microbiology 2022Quote: ... lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.25% deoxycholic acid, 1% NP-40, 1 mM EDTA; Millipore) supplemented with 1× protease inhibitor cocktail (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... Polymer blend of 1:1 weight ratio of 75:25 poly(lactide-co-glycolide acid) (Sigma Aldrich #719927) and polycaprolactone (Sigma Aldrich #440744 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Propionylation was carried out by adding 1 μL of a propionic acid solution (1% propionic anhydride, Sigma, 240311) with vortexing and incubation for 2 min ...