Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 10000+ citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: Human Methemoglobin (Ferrohemoglobin) was purchased from Sigma-Aldrich, Missouri ...
-
bioRxiv - Immunology 2024Quote: ... Complement C6 depleted human serum (C1288, Sigma-Aldrich), diluted to final concentration of 2% with dilution buffer (CH50 assay ...
-
bioRxiv - Immunology 2024Quote: ... Non-heat inactivated normal human serum (Sigma-Aldrich) was diluted 1:18 (100% ...
-
bioRxiv - Biophysics 2024Quote: ... and 5 IU human chorionic gonadotropin (hCG; Millipore) 48 h later ...
-
bioRxiv - Immunology 2024Quote: ... 800 ml of human Serum (Sigma Aldrich # H4522) were thawed at 37°C after addition of cOmplete™ ...
-
bioRxiv - Neuroscience 2024Quote: ... human citrated plasma (Sigma Cat No. P9523-1ML) was added and time to clot formation was recorded.
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% Human serum (Sigma H4522-100ML), 1% Pen/Strep (Thermofisher 15140-122 ...
-
bioRxiv - Genomics 2024Quote: ... + 5% Human Serum (Sigma-Aldrich catalogue number H4522) + 1% Penicillin-Streptomycin (Gibco catalogue number 15140122 ...
-
bioRxiv - Immunology 2024Quote: Recombinant human TNF-a (rTNF-α; Sigma #H8916) was resuspended in 1X PBS to a stock solution of 0.72ng/nl ...
-
bioRxiv - Immunology 2024Quote: ... and endotoxin-free recombinant human Albumin (Sigma A9731) at a final concentration of 5 mg/mL ...
-
bioRxiv - Immunology 2024Quote: ... and 5% human heat-inactivated AB serum (Sigma). The antibodies used for stimulation were anti-human CD3 (clone UCHT1 ...
-
bioRxiv - Immunology 2024Quote: ... an added positive human IgG Kappa (Sigma-Aldrich) loaded control lane was included (lane P) ...
-
bioRxiv - Genomics 2019Quote: ... we measured 41 different cytokines and chemokines using the Milliplex MAP Human Cytokine/Chemokine Magnetic Bead Panel (Millipore kit no. HCVD3-67CKHCYTOMAG-60K, Millipore Corp, St. Charles, MO). According to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Cytokines in BAL fluid samples were measured (pg/ml) in singlicate by Luminex using a Millipore human cytokine multiplex kits (EMD Millipore Corporation, Billerica, MA) according to manufactures instructions ...
-
bioRxiv - Pathology 2019Quote: ... and TGF-β1 in the samples was measured using magnetic bead-based multiple immunoassays (MILLIPLEX® MAP kit, Human High Sensitivity T Cell Magnetic Bead Panel: EMD Millipore Corporation, Germany). Each assay included two calibration curves for each of the proteins to be measured (calibration ranges ...
-
bioRxiv - Bioengineering 2021Quote: ... Mature human white-like adipocytes were transfected in the presence of fresh BM-1 medium supplemented with 1% human serum (Sigma, H4522) to mimic the subcutaneous tissue environment ...
-
bioRxiv - Immunology 2020Quote: ... Plates were washed 6 times with washing buffer and then incubated with anti-human IgG (Jackson Immuno Research 109-036-088) or anti-human IgA (Sigma A0295) secondary antibody conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated for 48 hours at 4°C with the following primary antibodies: anti-GBA (1:500; human 8E4; human and rodent G4171, Sigma-Aldrich), anti-human α-synuclein (syn211 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection for mature human white-like adipocytes was performed in the presence of fresh BM-1 medium supplemented with 1% human serum (Sigma, H4522). Both HeLa cells and mature human white like adipocytes were transfected with LNPs at a final mRNA concentration of 1.25μg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... The immortalized Podo/Tert256 human podocyte hTERT cell line (Evercyte) was expanded in flasks coated with 6 µg/cm2 human collagen I (Sigma, C7774) at 37°C in MCDB131 basal media (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... The human ORF sequence encoding for GSDMD was obtained from the Viral Vector Facility (LUMC) human ORF (cDNA) library from Sigma-Aldrich. The gene ORF was obtained in pDONR223 entry vectors and amplified by PCR with overhang primers to introduce partial sequences of an N-terminal FLAG-tag and C-terminal Myc-tag ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were isolated from human umbilical cords using collagenase type I (Sigma-Aldrich, 400 U/mL) to separate the cell layer surrounding the vein lumen ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Diflufenican (N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]-3-pyridinecarbox-amide) was purchased from Sigma-Aldrich (Taufkirchen, Germany). Diflufenican metabolites AE B107137 (2-[3-(Trifluoromethyl)phenoxy]nicotinic acid ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was prepared from a 3 ml culture of the representative strain using the GenElute ™ Bacterial Genomic DNA Kit (Sigma Aldrich, Sweden) [7].
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... sodium-3-methyl-2-oxobutyrate (ketovaline, Sigma), 3-methyl-2-oxovaleric acid sodium salt (ketoisoleucine ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 μM Indole-3-acetic acid (Sigma) was added 8 h after released ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Sigma), 50mM EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...