Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 8155 citations for BD 3 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... α14-3-3sigma (1:5000, Sigma, #PLA0201), α14-3-3pan (1:1000 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... quinine solution (3 g/l, Sigma-Aldrich) was put in one corner (the most prefered corner during the last day before avoidance training ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 3 pmol of each primer (Sigma-Aldrich) and 2 μl of extracted DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 mM 3-(Benzyldimethyl-ammonio) propanesulfonate (Sigma), 3.0 μM polyethylenimine (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Sodium Selenite (Sigma-Aldrich #S5261), 2.08 μg/mL Progesterone (Sigma-Aldrich #P8783) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3-indoleacetic acid (IAA) (Sigma-Aldrich, I2886) was added to the final concentration of 0.2 mg/mL and cultured for additional 2.5 h ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed with 3% PFA (Sigma) for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... fixed with 3% paraformaldehyde (PFA) (Sigma-Aldrich) and permeabilized with 0.5% triton X100 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM MgCl2 (Sigma-Aldrich, Cat. # M1028), 0.05% Nonidet P40 Substitute (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... plates containing LB (Miller, BD, Sigma) or LB supplemented with 50ug/mL gentamicin (GoldBio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3×FLAG::GFP-tagged protein and associated RNAs were eluted with 100 μg/mL 3×FLAG peptide (Sigma). The eluates were incubated with TRIzol reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... and murine interleukin 3 (IL3)-producing WEHI-3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% FBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Bioengineering 2022Quote: ... and then crosslinked with carbodiimide chemistry in PBS solution:1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Sigma-Aldrich) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Plant Biology 2019Quote: ... Labeled standards for indole-3-acetic acid and N-(3-indolylacetyl)-DL-aspartic acid were obtained from Sigma-Aldrich. Calibration curves were linear (r values = >0.99 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mmI.D. x 150 mmL, 3 μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biophysics 2022Quote: 1,2-dioleoyl-sn-glycero-3-phosphocoline (DOPC) (TebuBio) and 1,2-dioleoyl-sn-glycero-3-phospho(1’-rac-glycerol) (sodium salt) (DOPG) (Sigma) were dissolved in chloroform ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 3×106 co-transformants was initially screened for growth on synthetic defined media (SD)-Leu-/ Trp-/ Ura-/ His- media containing 20mM of 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich). Plasmids were isolated from the potential positive colonies ...
-
bioRxiv - Cell Biology 2022Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Immunology 2020Quote: The following reagents were used in this study: 3-methyladenine (3-MA; M9281; Sigma-Aldrich, St. Louis, MO, USA), dimethylsulfoxide (D2650 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Cancer Biology 2019Quote: CT26 cells that had been stably transduced with PCK1-targetting shRNA hairpins or control hairpins were grown in vitro for 3 days and counted on day 3 using the Sceptor 2.0 automated Cell counter (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... harvested at day 3 and clarified by centrifugation at 350 x g for 15 minutes (Sigma 3-16K centrifuge). Viral stocks were concentrated by centrifugation at 11 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or chemically crosslinked (small RNA blots) by incubation with 0.16 M l-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Sigma) in 0.13 M 1-methylimidazole (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sigma)10,42 and the metabotropic glutamate receptor antagonist DL-2-Amino-3-phosphonopropionic acid (AP-3) ([1mg/kg] in PBS, stock made in 1M NaOH diluted, pH 7.4; Sigma)10,43 ...
-
bioRxiv - Biophysics 2022Quote: Peak fractions of the PEAK3/14-3-3 complex were pooled and concentrated using an Amicon Ultra-0.5 30k MWCO centrifugal filter (Millipore). Immediately before preparing cryo-EM grids ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm long, 3 µm particle size, Sigma–Aldrich) at a flow rate of 0.25 ml min−1 with a step gradient of mobile phase A (0.1% formic acid ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Microbiology 2023Quote: ... was subjected to centrifugation through a 3 kDa cut-off membrane filter (Amicon Ultra-0.5 3-kDa Ultracell, Millipore) at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... coverslips were thiol-silanised by submerging for 3 hrs in a 10% solution of (3-Mercaptopropyl)trimethoxysilane (Sigma-Aldrich) in toluene before tempering by incubating at 100°C for 1 hr.
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaves with expressing effectors were immersed in 1 mg/ml DAB (3, 3′-diaminobenzidine) solution (Sigma-Aldrich, USA) at 25°C for 8 h ...
-
bioRxiv - Immunology 2023Quote: ... SRBCs in Alsever’s (TCS Bioscience) were conjugated to recombinant HEL3X (R. Brink) with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma) as previously described104 ...
-
bioRxiv - Cancer Biology 2023Quote: ... blocked in 3 % BSA/PBS and incubated with anti-ZEB1 antibodies (Sigma, HPA027524, 1:200 in 3 % BSA/PBS). After washing and incubation with Alexa594-conjugated secondary antibodies (Life Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Neuroscience 2024Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were separated on a Discovery HS F5-3 column (2.1 mm i.d. × 150 mm, particle size 3 μm, Sigma-Aldrich) using mobile phase A (0.1% formic acid/water ...
-
bioRxiv - Neuroscience 2021Quote: ... The following primary and secondary antibodies were used: rat anti-SST (1:200, Millipore #MAB354), chicken anti-PV (1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies were used at the following dilutions: rat anti-HA epitope IgG1 (clone 3F10; Sigma) at 1:5,000 ...
-
bioRxiv - Physiology 2019Quote: ... RT-qPCR was carried out as previously described [20] using rat-specific oligonucleotide primers (Sigma) or FAM-MGB Taqman probes (see Supp Table 1 for primer list) ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by incubation with mouse anti-rat GFP and CD90 antibodies (1:100; Sigma-Aldrich) overnight at 4°C ...