Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for IL 2 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... then were incubated with both mouse anti-IgG4 and a rabbit polyclonal anti-human IL-5Rα Ab (Sigma PA5-25159) or rabbit IgG in the first step ...
-
bioRxiv - Cancer Biology 2022Quote: ... were cultured in the presence of recombinant mouse IL-4 (25 ng/mL; #404-ML, R&D) and LPS (20 μg/mL; #L2880, Sigma) over night to induce B cell activation and terminal differentiation ...
-
bioRxiv - Genetics 2020Quote: ... Specific primers for mouse leptin and 2 mouse housekeeping genes used for normalization (β-actin and 34B4 mouse genes) were purchased from Sigma (Sigma, France). We used primers for Leptin (forward ...
-
bioRxiv - Immunology 2021Quote: ... 10ng/ml IL-4 (Sigma), 40nM LY2090314 (Sigma).
-
bioRxiv - Immunology 2021Quote: ... + 0.4ng/ml IL-7 (Sigma)+40µl/ml IL-7 (obtained from IL-7 producing J558L cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and IL-6 (Sigma-Aldrich) treatments were performed at a concentration of 50 units/mL and 50 ng/mL in cDMEM ...
-
bioRxiv - Biochemistry 2022Quote: ... also contained 1-2 µg/uL α-MBPAF546 or 1-2 µg/uL mouse α-BRCA2 (Ab1, Millipore) plus 1-2 µg/µL goat α-mouse IgGAF546 (Molecular Probes).
-
bioRxiv - Immunology 2021Quote: ... 106 cells/ml in 500ul of regular medium supplemented with IL-2 500UI in presence of protamine-sulfate at 20ug/ml (Sigma). The plates were then centrifuged at 1,000 g for 1 h and incubated at 37°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... according to the manufacturer’s instructions and activated by incubation in the presence of 100 U/ml IL-2 (Sigma Aldrich) and T Cell TransAct™ human (Miltenyi Biotec ...
-
bioRxiv - Immunology 2022Quote: ... expanded in the presence of recombinant human IL-2 (1000 U/mL, Proleukin) and rapamycin (50 nmol/L, Sigma-Aldrich), and transduced after 2 days ...
-
bioRxiv - Immunology 2023Quote: ... Sorted Treg cultures also contained 1000 U/mL of IL-2 (Proleukin) and 50 nmol/L of rapamycin (Sigma- Aldrich), whereas Tconv cultures contained 100 U/mL of IL-2 ...
-
bioRxiv - Immunology 2024Quote: ... Human PBMC were pre-activated with 30 ng/ml anti-CD3 (OKT3, Miltenyi) and 50 IU/ml IL-2 (Sigma) and subsequently transduced two times with viral supernatant in the presence of 6 ug/ml polybrene (Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Pathology 2021Quote: ... Mouse anti-E2F4 monoclonal antibody (mAb) clone LLF4-2 (MABE160; Merck Millipore) used at 1/400 for PLA ...
-
bioRxiv - Pathology 2021Quote: ... 1 μg/mL natural mouse laminin and 2 μM Arabinosylcytosine (Sigma-Aldrich). 48 hours later NSM medium was fully exchanged ...
-
bioRxiv - Cancer Biology 2019Quote: ... α-tubulin mouse (1:10000 WB, clone B-5-1-2, Sigma-Aldrich), p120 catenin mouse (1:1000 WB ...
-
bioRxiv - Biophysics 2022Quote: ... and mouse myotubes were treated with thapsigargin (2 μg mL-1; Sigma) for 10 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-glutamate receptor 2 (mouse anti-GluR2 IgG2a; Millipore; 1:2000). Sections were then washed with PBS and incubated in Alexa Fluor-conjugated fluorescent secondary antibodies (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal against alpha-tubulin (1:1000; b5-1-2, Sigma, T6074). Actin was stained using 100 nM of phalloidin-iFluor488 for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Immunology 2020Quote: ... were cultured at a concentration of 1 million cells per ml in complete media on pre-incubated anti-CD3/anti-CD28 bound plates in IL-2 (20ng/ml) (Sigma-Aldrich) for 2 days and then just IL-2 (20ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: Fluorescent immunostaining for nuclear NFκB and cytoplasmic NFκB was quantified in immortalized C8D30 astrocytes following 2-hr treatment with 1μg/ml LPS or a cocktail of 3 cytokines: Il-1α (3ng/ml, Sigma, Cat# I3901), TNFα (30ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs cultures not supplemented with IL-2 overnight were stimulated with 25 ng/ml phorbol 12-myristate-13-acetate (PMA) (Sigma-Aldrich) and 1 μg/ml ionomycin (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and subsequently transduced twice with viral supernatant within 48 hrs in the presence of 50 IU/mL IL-2 and 6 mg/mL polybrene (Sigma-Aldrich). TCR-transduced T cells were expanded by stimulation with anti-CD3/CD28 Dynabeads (500,000 beads/106 cells ...
-
bioRxiv - Immunology 2022Quote: ... All cocultures were maintained in SCGM supplemented with IL-2 (120 IU/ml) and in the presence of 10 µM raltegravir (Sigma-Aldrich) and 0.4 µM nevirapine (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... virus supernatant was aspirated and preactivated PBMCs (0.5-0.8 x 106/well) in TexMACS medium supplemented with 100 IU/ml IL-2 and 6 ng/ml polybrene (Sigma-Aldrich) were added to each well ...
-
bioRxiv - Microbiology 2023Quote: ... or IL-1RA (SRP3327, Sigma-Aldrich). At the indicated time points ...
-
bioRxiv - Neuroscience 2023Quote: ... Lithium chloride (LiCl; Sigma-Aldrich, IL) was dissolved in water to a concentration of 0.15M and administered intraperitoneally (10 mL/kg).
-
bioRxiv - Molecular Biology 2022Quote: ... IL-4 (5 ng/ml; Sigma) 0.5 μg/ml of anti-CD180 (RP105 ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... IL-1α (3 ng/ml; Sigma), and C1q (400 ng/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 ng/mL IL-4 (Sigma), and 0.5 ug/mL anti-CD180 (BD Pharmingen ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting hybridoma cells were plated onto 96-well plates and cultured in HAT selection medium (Hybridoma-SFM [Life Technologies, Grand Island, CA, USA]; 10% FBS; 1 ng/mL mouse IL-6; 100 μM hypoxanthine [Sigma-Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... the membranes were incubated with the appropriate horseradish-peroxidase conjugated secondary Ab (1:5000 in TBST + 2% BSA; 2 h at room temperature; anti-mouse A4416 and anti-rabbit A0545, Sigma). The immunoreactivity was detected by ECL reagents (Amersham) ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K, Millipore MA).
-
bioRxiv - Neuroscience 2019Quote: ... and anti-α-Tubulin (mouse monoclonal [B-5-1-2], 1:8,000, Sigma).
-
bioRxiv - Neuroscience 2019Quote: ... anti-microtubule associated protein 2 (MAP2, 1:500, mouse monoclonal, Sigma, St.Louis, MO), GluN2B (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse mAb anti-α-Tubulin (Sigma-Aldrich, clone B-5-1-2, #T5168); mouse mAb anti-Flag M2 (Sigma-Aldrich #F1804) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-Centrin-2 (1:250, clone 20H5, 04-1624, Merck Millipore), rabbit polyclonal anti-WDR90 (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... and (3) GluA2 (mouse anti-glutamate receptor 2; Millipore; used at 1:2000). Cochlear pieces were incubated in species appropriate secondary antibodies coupled to Alexa Fluors in the red ...
-
bioRxiv - Microbiology 2021Quote: ... for SARS CoV-2 spike detection mouse anti-spike (Cat# ZMS1076, Sigma Aldrich) respectively ...
-
bioRxiv - Biophysics 2020Quote: ... or 2 ng/µl mouse anti-beta-tubulin primary antibody (Sigma-Aldrich, T8328), the clathrin samples were incubated with 2 ng/µl rabbit anti-clathrin primary antibody (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-actinin-2 (a7811) was purchased from Sigma Aldrich (St. Louis, MO). Rabbit anti-phosphoYAP (13008S ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse α-Tubulin (Sigma, B-5-1-2, # T5168, used at 1:5000), mouse α-FLAG (Sigma ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-activated MAP kinase (diphosphorylated ERK-1&2, 1:20; Sigma-Aldrich), and rabbit anti-Sty (1:50 ...
-
bioRxiv - Immunology 2022Quote: ... was combined with mouse anti-Map2 (#M4403, Sigma, clone HM-2, 1:100) to co-label neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Tropomyosin 1 and 2 (T2780, clone name-TM311, Sigma-Aldrich, 014M4782) and mouse anti-Tropomyosin 3 (CG3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... using 2 μg/ml mouse monoclonal anti-flag for ESRRB (M2 Sigma, F3165) and 1μg/ml polyclonal rabbit anti-HA for NR5A2 (Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-alpha Tubulin (clone B-5-1-2, Sigma-Aldrich, #T6074), rabbit polyclonal anti-GFP (Origene ...