Labshake search
Citations for Millipore Sigma :
101 - 150 of 420 citations for GSK3B siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... siRNA Universal Control 1 (Sigma-Aldrich SIC001) was used as control ...
-
bioRxiv - Cell Biology 2020Quote: ... All siRNAs were synthesized by Sigma-Aldrich with dTdT 3’-overhangs.
-
bioRxiv - Cancer Biology 2021Quote: The siRNAs targeting STAT3#1 (#HA13744330, Sigma), STAT3#2 (#HA13744332 ...
-
bioRxiv - Cancer Biology 2021Quote: MISSION siRNA Universal Negative Control#1 (Sigma) and a siRNA against the Luciferase Reporter (sense ...
-
bioRxiv - Cancer Biology 2021Quote: Predesigned FASN siRNAs were from Millipore Sigma (#1 ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA Universal Negative Control #2 (Sigma-Aldrich) was used as a control in all RNA interference experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... All siRNAs were purchased from Sigma-Aldrich.
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... MISSION siRNA Universal Negative Controls (Sigma-Aldrich) or DS scrambled negative control siRNA (IDT ...
-
bioRxiv - Cell Biology 2021Quote: ... and control-siRNA were obtained from Sigma. Neuro2a cells were transfected with each siRNA for 5 h using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Genetics 2019Quote: ... MISSION siRNA Universal Negative Control (Sigma Aldrich) was used as a control ...
-
bioRxiv - Cell Biology 2021Quote: ... Mission siRNA universal negative control (SIC001; Sigma), ANKRD28 siRNAs (SASI_Hs01-00173856 ...
-
bioRxiv - Molecular Biology 2022Quote: Synthetic short interfering RNA (siRNA) oligonucleotides (Sigma) were delivered into cells using Lipofectamine RNAi Max with the reverse transfection protocol according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... or scramble non-specific siRNA (Sigma Aldrich St ...
-
bioRxiv - Cell Biology 2022Quote: The siRNA targeting VPS35 was from Sigma (5’ CTGGACATATTTATCAATATA 3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... All siRNAs were purchased from Sigma Aldrich. After 4 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... All siRNAs were purchased from Sigma-Aldrich: siRNA TopBP1-A-CUCACCUUAUUGCAGGAGA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs were custom synthesized from Millipore Sigma, and MISSION® siRNA Universal Negative Control #1 (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... All siRNAs were purchased from Sigma-Aldrich: siRNA TopBP1-A-CUCACCUUAUUGCAGGAGA(dTdT) ...
-
bioRxiv - Cell Biology 2023Quote: siRNA duplexes were obtained from Sigma-Aldrich or Dharmacon (Table EV2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All siRNAs were purchased from Sigma-Aldrich: siRNA p300-A,5’-TTGGACTACCCTATCAAGTAA-3’ ...
-
bioRxiv - Cell Biology 2024Quote: siRNA duplexes were obtained from Sigma-Aldrich or Dharmacon (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The shRNA plasmid to knockdown mouse Tenascin-R (GeneID:21960) was cloned by the insertion of the siRNA’s sequence (siRNA ID: SASI_Mm01_00073137, Rosetta Predictions from Sigma Aldrich, Merck) targeting the open reading frame of mouse Tenascin-R into adeno-associated viral (AAV ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Microbiology 2022Quote: ... siRNA UGCG 2: GGUUACACCUCAACAAGAA, UUCUUGUUGAGGUGUAACC) and siRNA negative control (scrambled: AGUAUUGAAUUUGCGACAA, UUGUCGCAAAUUCAAUACU) were designed by and obtained from Sigma–Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 2 × 106 BMDMs in a cuvette was transfected with 500 pmol of MISSION® siRNA Universal Negative Control #1 or TLN1 siRNA (ID: SASI_Mm01_00114842) (Sigma) with the protocol “Mouse ...
-
bioRxiv - Cancer Biology 2020Quote: ... Germany) single 250 V pulse for 10ms with 300mM of MYB siRNA or a scrambled negative control siRNA (SIGMA ALDRICH) as previously reported in Clarke et al (Clarke et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... satellite cells were transfected after 48h culture with siRNAs against Tacc3 (20nM) or Mission® siRNA Universal Negative control (Sigma) with jetPRIME® transfection reagent (Illkirch-Graffenstaden ...
-
bioRxiv - Developmental Biology 2019Quote: ... the S2 cells were transfected with 450 picomoles of siRNA for dIno80 and control siRNA (SIC001, Sigma, Missouri, Unites States) at 50% confluency in a T-75 flask ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with human ASCL1 stealth siRNA (129901-HSS100744, Thermo-Fisher) using X-tremeGENE siRNA Transfection Reagent (4476115001, Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Non-targeting control siRNA (MISSION® siRNA Universal Negative Control #1) and LRRK2 siRNA #1 (targeting LRRK2 sequence 5’-ctcgtcgacttatacgtgtaa-3’; 37) were purchased from Sigma. LRRK2 siRNA #2 was purchased from ThermoFisher (ID ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Molecular Biology 2022Quote: U2OS FlpIn 6xHIS-FLAG SUMO1 or SUMO2 cells were plated on 15 cm2 plates at 5×106 for 24 hours prior to siRNA depletion with either 10 nM SUMO1 or 10 nM each of SUMO2 and SUMO3 siRNA (SIGMA). Doxycycline (1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were transfected with 2 µg of scrambled siRNA (MISSION siRNA Universal Negative Control #2 Sigma-Aldrich SIC002-5x1nmol) or 2 µg of MATR3 siRNA (MISSION esiRNA human MATR3 Sigma-Aldrich EHU113801-50UG ...
-
bioRxiv - Cancer Biology 2023Quote: NKX3.1 expression was inhibited using siRNA against the NKX3.1 gene (WD10664038) as well as universal negative control SiRNA#1 (SIC001) was purchased from Sigma Aldrich. 70-90% of confluent cells were replaced with Opti-MEM ...
-
bioRxiv - Cell Biology 2023Quote: ... Moreover, a non-targeting control siRNA (NT siRNA, or siCON) with the sequence 5’-CGUACUGCUUGCGAUACGGUU-3’ was used (Sigma-Aldrich). Cells were transfected with 22 pmol of siRNA oligonucleotides/well using Lipofectamine RNAiMAX (ThermoFisher Scientifc ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following siRNAs were purchased from Sigma Aldrich: siTASOR ...
-
bioRxiv - Cancer Biology 2020Quote: ... or siRNA Universal Negative Control (Sigma-Aldrich, SIC001) at 60% - 80% confluency by using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2022Quote: Commercially available siRNA oligos targeting PARP1 (Sigma, SASI_Hs01_0033277), PARP2 (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... All siRNA molecules were synthesized by Sigma-Aldrich. Sequences of all siRNA molecules are listed in Table S1.
-
bioRxiv - Molecular Biology 2020Quote: ... MISSION siRNA Universal Negative Control #1 (Sigma-Aldrich) was used as a negative control ...
-
bioRxiv - Immunology 2019Quote: ... or siRNA specific for viperin (SASI_Hs02_00362416; Sigma Aldrich) by a Nucleofector 2b Device (Lonza) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 nM siRNA targeting SMNDC1 (SASI_Hs01 00210371, Sigma), or negative control siRNA (SIC001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The siRNAs used were siPNUTS (Sigma-Aldrich Hs01_00133264), siSEMA3B (Dharmacon ...
-
bioRxiv - Synthetic Biology 2020Quote: An orthogonal siRNA approach called esiRNA (Sigma Aldrich) was employed to target PDIA4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... MISSION siRNA Universal Negative Control #1 (Sigma-Aldrich) was used as a negative control.
-
bioRxiv - Cancer Biology 2020Quote: ... and siRNA pools were purchased from Sigma-Aldrich. Stable cell lines were maintained in presence of specified antibiotics at recommended concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Single ErbB4 siRNAs were ordered from Millipore Sigma (ErbB#1 GCAAGAAUUGACUCGAAU ...
-
bioRxiv - Developmental Biology 2020Quote: ... and pre-designed siRNA against POU3F1 (Sigma, SASI_Mm02_00319981) and REST(Sigma ...