Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for 6 Aminoindan 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-acetylated tubulin clone 6-11B-1 (1:500, Sigma-Aldrich, T6793), mouse anti-gamma tubulin GTU-88 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-acetylated tubulin at 1:1000 (6-11B-1, Sigma-Aldrich). Fluorescent secondary antibodies conjugated to AlexaFluor488 and AlexaFluor564 were used at 1:500 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-acetylated tubulin (Sigma-Aldrich, clone 6-11B-1, 1:1000) rabbit polyclonal anti-POC5 (A303-341A-T ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-acetylated α-tubulin (1:2,000; 6–11B-1; Sigma-Aldrich T6793), rat anti–E-cadherin (1:1,000 ...
-
bioRxiv - Immunology 2023Quote: ... one 32-plex and one 13-plex (Sigma, Burlington, Massachusetts, USA). The assay was run according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Four days after the intravenous injection of 106 iRBC into C57BL/6 mice pre-treated one day earlier with phenylhydrazine 97% (Sigma-Aldrich, 6.18µl/ml) 1 ml of fresh mouse blood was mixed with 10 ml of ookinete medium ...
-
bioRxiv - Neuroscience 2022Quote: One day before plating, 6-well MEA plates (Axion Biosystems, M384-tMEA-6W) were coated with poly-D-lysine (Millipore Sigma P6407-5MG) in borate buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:1000; Sigma) was used as nuclear counterstaining ...
-
bioRxiv - Microbiology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma-Aldrich) was used for nuclei staining and added to the secondary antibody solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Neuroscience 2020Quote: ... Before injecting 6-hydroxydopamine (6-OHDA, Sigma), mice were first treated with a mix of desipramine (25 mg/kg ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-Aminonicotinamide (6-AN) 2 μM (SIGMA), S-(5′-Adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Developmental Biology 2023Quote: 6-Hydroxydopamine hydrochloride (6-OHDA) (Sigma, H4381)
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-acetylated tubulin (6-11B-1; 1:1000 for IF; Cat#6793, Sigma), mouse monoclonal anti-glutamylated tubulin (B3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Millipore-Sigma, cat#: MABT868), 1:600 rabbit anti-FMRFamide (Immunostar ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Millipore-Sigma, cat#: MABT868), 1:600 rabbit anti-FMRFamide (Immunostar ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse acetylated tubulin antibody was incubated at 1:1000 from Sigma (6-11B-1). Secondaries Alexa fluorophores anti-rabbit 488 and anti-mouse 647 were used at 1:1000 dilutions.
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-acetylated α-tubulin clone 6-11B-1 1:100 (Sigma Aldrich) and mouse polyclonal anti-PAR2 1:100 (T ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-acetylated α-tubulin clone 6-11B-1 1:2000 (Sigma Aldrich). Bound antibodies were detected using peroxidase-labeled anti-rabbit IgG (GE Healthcare) ...
-
bioRxiv - Zoology 2019Quote: Primary antibodies: mouse monoclonal 6-11B-1 for acetylated tubulin (diluted 1:1000; Sigma), mouse monoclonal 3C11 for synapsin (SYNORF1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma, 1:2000 in 1× PBS) for 5’ and mounted with fluorescent mounting medium (Dako) ...
-
bioRxiv - Neuroscience 2024Quote: ... One group of mice (referred to as DMI + 6-OHDA) was pre-treated with one injection of desipramine hydrochloride (DMI, Sigma-Aldrich, 25mg/kg i.p.) 30 minutes before the 6-OHDA infusion in order to protect the noradrenergic system [50].
-
bioRxiv - Microbiology 2019Quote: ... One tube of lysate was treated with 1 μL of trehalase (Sigma-Aldrich) enzyme or vehicle control ...
-
bioRxiv - Cell Biology 2022Quote: ... One 10 cm plate per condition was lysed 1 ml RIPA buffer (Sigma) and Halt Protease Inhibitor Cocktail (Thermo) ...
-
bioRxiv - Cancer Biology 2019Quote: ... One hour incubation in blocking solution containing 1% Bovine Serum Albumin (Sigma, A7906), 2% goat serum (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... 1% Triton X-100 and one EDTA-free protease inhibitor tablet (Sigma Aldrich) for 5 min on ice and then sonicated ...
-
bioRxiv - Genomics 2024Quote: ... One microgram of RNA was treated with 1 U of DNaseI (Sigma-Aldrich) following the manufacturer’s instructions for 15 min at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... truncatula seedlings were transferred to Fahräeus medium supplemented with water (mock treatment) or 1 μM of 6-BAP (6-benzylaminopurine; Sigma-Aldrich) and maintained under the same growth conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... DAPI (4’,6-Diamidino-2-phenylindole dihydrochloride, 1:200, Sigma-Aldrich) staining was performed to visualize nuclei ...