Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... followed by eosin (Sigma Aldrich # 1508694-9) staining for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... Cdk1: 9 µM RO3306 (Sigma Aldrich: SML0569), Plk1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 9 units of DNase I (Sigma) in L15++ media) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9- THF-Ade (SQ22536, C355, Sigma-Aldrich). N-[2-(p-Bromocinnamylamino)ethyl]-5- isoquinolinesulfonamine dihydrochloride (H89 ...
-
bioRxiv - Neuroscience 2023Quote: ... Linopirdine (1.5 μM, Sigma, #105431-72-9), 4-AP (10 μM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... forskolin (FSK; Sigma-Aldrich, 66575-29-9). Valerian extract Ze 911 was kindly provided by Max Zeller Söhne AG (Romanshorn ...
-
bioRxiv - Cell Biology 2023Quote: ... RO-3306: 9 µM (SML-0569; Sigma).
-
bioRxiv - Plant Biology 2023Quote: ... 0.01 μM CoCl2 (7646-79-9, Sigma), 0.2 μM Na2MoO4 (10102-40-6 ...
-
bioRxiv - Microbiology 2023Quote: ... LdtAVc 9 were cloned on pET28b(+) (Novagen) with C-terminal His-tags for expression in E ...
-
bioRxiv - Bioengineering 2023Quote: ... and 9% EDTA 2Na 2H20 (Sigma E5134) in sterilized deionized water ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytochalasin B (Sigma), and 1,2-dipalmitoyl-sn-glycerol (Sigma D9135)
-
bioRxiv - Microbiology 2020Quote: ... Polymyxin B (Sigma) was used as a positive control due to its outer membrane permeabilizing property.
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (Sigma) was dissolved freshly in MFSW from frozen aliquots at 20 mM in DMSO ...
-
bioRxiv - Biophysics 2020Quote: ... Latrunculin B (Sigma) was resuspended in DMSO to a concentration of 12.6 mM and used at 1μM for 1 hour before AFM measurements.
-
bioRxiv - Cancer Biology 2021Quote: ... B-actin (Sigma), Total PARP (CST) ...
-
bioRxiv - Physiology 2024Quote: ... cocktail B (Sigma) and for Na+ measurements we used a Na+ ionophore X (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... CelLytic B (Sigma) was included as positive control.
-
bioRxiv - Cell Biology 2024Quote: ... MAPa/b (Sigma), NANOG (Abcam) ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgSO4, 5 mM 6-aminocaproic acid (Sigma, cat. #A2504), 5 mM benzamidine (Sigma ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Developmental Biology 2024Quote: Larval brains expressing UAS-GFP::utABD under grh-GAL4 at 6h ALH were dissected in Shield and Sang M3 insect medium (Sigma-Aldrich, Cat. S8398) supplemented with 10% FBS ...
-
bioRxiv - Developmental Biology 2024Quote: Larval brains expressing UAS-GFP-Moe or UAS-GFP-utABD under grh-GAL4 at 6h ALH were dissected in a mixture of Shield and Sang M3 insect medium (Sigma-Aldrich, Cat. S8398) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with 20nM BubR1 siRNA (5′-AGAUCCUGGCUAACUGUUC-3’) (Sigma-Aldrich) or 20nM Knl1 dsiRNA (5’-ATGCATGTATCTCTTAAGGA AGATGAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5′ to 3′ Primer sequences: Custom primers were obtained from Sigma-Aldrich, St ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Microbiology 2019Quote: ... and [5-(2-thienyl)-3-isoxazolyl]methanol were obtained from Sigma-Aldrich, MO (Table 1) ...
-
bioRxiv - Genomics 2019Quote: ... were washed 3 times with a 5 mg/mL BSA (Sigma A9418) solution ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Cell Biology 2024Quote: ... and siTGN46 with 5’-CCACCGAAAGCGUCAAGCAAGAAGA-3’ sequence were obtained from Sigma-Aldrich. Huh7-ACE2 cells were transfected with siRNA oligos (final concentration ...
-
bioRxiv - Genetics 2024Quote: ... then 5 IU of hCG (Millipore Sigma, Cat# 9002-61-3 C1063) 48 hr later ...
-
bioRxiv - Molecular Biology 2024Quote: Sym/Sub RNA with sequence 5 [GCAUGGGCCC 3 [was synthesised (Sigma Aldrich) and 5′ end labelled using γ32P UTP (Perking Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2023Quote: ... including Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8Br-cAMP, Sigma B7880), N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (DB-cAMP ...
-
bioRxiv - Cell Biology 2023Quote: ... The coverslips were treated for 5 min with APES (3-Aminopropyltriethoxysilane, Sigma) and thoroughly rinsed ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked with 3% BSA in PBS and 5% Goat Serum (Sigma, #G9023) for 1h before being incubated with primary antibodies in 3% BSA in PBS for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... eGFP reverse: 5′-AAG TCG TGC TGC TTC ATG TG -3′ (Sigma); GAPDH forward ...
-
bioRxiv - Developmental Biology 2021Quote: ... in the presence of digoxigenin-11-UTP (Sigma), from PCR fragments amplified from embryonic zebrafish cDNA (Table S4) ...
-
bioRxiv - Developmental Biology 2019Quote: ... supplemented with digoxigenin-11-UTP (Roche, Sigma-Aldrich) following standard procedures ...
-
bioRxiv - Bioengineering 2021Quote: ... 11% (w/w) 10kDa dextran (Sigma Aldrich, D9260), and 1.54mg/mL dithiothreitol (DTT ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 11 containing protease inhibitors cocktail (Sigma-Aldrich) by sonication using three rounds of probe-tip sonication at 40% output for 20 s with 30 s resting on ice ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.08% collagenase D (Sigma, 11 088 882 001), 0.1% trypsin (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: ... 20 μM hapten/fluor [digoxigenin-11-dUTP (Sigma); Cy3 dUTP (GE Healthcare)] ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 11 mM D-Glucose (Sigma Aldrich), 0.5% w/v AlbuMAX II (Invitrogen) ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 % Sodium Pyruvate (11 mg ml−1, Sigma), 1 % Gibco MEM NEAA (non-essential amino acids ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 11-deoxycorticosterone (DOC) obtained from Sigma-Aldrich and Steraloids ...