Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for 6 Fluoro 4 hydroxy 1 7 naphthyridine 3 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were left to dry completely before being mounted with 6 µl of Mowiol 4-88 (Sigma) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and finally resuspended in FACS buffer containing 0.1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI, Sigma). Data collection occurred on a BD Biosciences LSRFortessa 3 and a gating strategy was used to isolate live ...
-
bioRxiv - Bioengineering 2023Quote: ... Nuclear staining was performed through incubation of 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, D8417) diluted 1:250 in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were stained with 4’,6-diamidino-2-phenylindole (DAPI; 0.5 μg/ml, Sigma-Aldrich, cat# D8417) diluted in PB to label cell nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed thrice in PBS and incubated with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma, #D9542) diluted 1:10,000 in PBS for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 mM 4-methylumbelliferyl N-acetyl-β- D-glucosaminide-6-sulfate (HEXA; Sigma Aldrich, MS, USA) in 0.1 M citric acid/NaOH buffer (pH 4.4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Microbiology 2022Quote: ... The hydrogel was then prepared by slowly adding 5 g hydroxy ethyl cellulose (Sigma Aldrich, St. Louis, Missouri, USA) under constant ...
-
bioRxiv - Genomics 2021Quote: ... A1413301)-coated 12-well plates at a density in the range of 3-7×105 cells per well in iPS-Brew + 2μM Thiazovivin (Sigma, cat. SML1045-5MG). Alternatively ...
-
bioRxiv - Neuroscience 2020Quote: ... were prepared for NMR by combining 16 µL standard with 50 µL serum and placing in a 3 mm NMR tubes (Wilmad®, 7 inch; Sigma-Aldrich).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Methyl methanesulphonate (MMS) (#129925) (CAS registry number 66-27-3) and carbendazim (#378674) (CAS no. 10605-21-7) were purchased from Sigma-Aldrich (Merck), UK.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 3 and 7 post-drug or vehicle administration were analyzed to quantify urea levels with a urea assay kit (Sigma-Aldrich, MAK006) according to vendor-provided protocol ...
-
bioRxiv - Immunology 2023Quote: ... human peripheral blood-derived cells were stained with 7-aminoactinomycin D (7-AAD, Sigma) or LIVE/DEAD® viability markers (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Plant Biology 2022Quote: Proteasome activity was measured using the fluorogenic substrate N-Succinyl-Leu-Leu-Val-Tyr-7-Amido-4-Methylcoumarin (Millipore Sigma; S6510) as described Üstün et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resultant pellets were resuspended in 100 μl of 1X PBS then incubated with 7 μl of 4% (w/v) phosphotungstic acid (Sigma-Aldrich) in 0.2 M magnesium chloride ...
-
bioRxiv - Cancer Biology 2023Quote: ... organoids were seeded in 15-well IBIDI angiogenesis chambers during passaging and fixed 7-12 days later in 4% paraformaldehyde (PFA) (Sigma-Aldrich) for 60 min at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... total cellular ERAP2 protein was enriched by immunoprecipitation and incubated with L-Arginine-7-amido-4-methylcoumarin hydrochloride (R-AMC, A2027, Sigma-Aldrich). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: Proteasome activity was measured by spectrofluorometry using the 7-amino-4-methylcoumarin (AMC)-labeled fluorogenic substrate succinate-LLVY-AMC (Roche Sigma-Aldrich) in cleared extracts of leaf 1 at different dpg (Üstün and Börnke ...
-
bioRxiv - Cancer Biology 2024Quote: ... Two sets of four EV-rich fractions (7–12 and 16-22) were pooled and concentrated using Amicon Ultra-4 10 kDa centrifugal filter device (Merck Millipore, USA). Alternatively ...
-
bioRxiv - Cancer Biology 2021Quote: ... 7 µM (Sigma-Aldrich SML0569)
-
bioRxiv - Immunology 2021Quote: ... + 0.4ng/ml IL-7 (Sigma)+40µl/ml IL-7 (obtained from IL-7 producing J558L cells ...
-
bioRxiv - Biochemistry 2020Quote: ... 7-dehydrocholesterol (Sigma Aldrich, DE), cholesterol and ergosterol (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... 10−7 M dexamethasone (Sigma), 10 mM nicotinamide (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 7-dehydrocholesterol (Sigma Aldrich, DE), cholesterol and ergosterol (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 mM pyruvate (Sigma-Aldrich), and 1 mM malate (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 7’-dichlorofluorescin diacetate (H2DCFDA; Sigma) staining ...
-
bioRxiv - Neuroscience 2021Quote: ... 7% donkey normal serum (Sigma). The primary antibodies used were ...
-
bioRxiv - Microbiology 2021Quote: ... 7-aminoactinomycin D (Sigma Aldrich) were included during sample preparation according to the manufacturer’s instructions to identify dead cells.
-
bioRxiv - Microbiology 2022Quote: ... 7-Le (Sigma-Aldrich France), 2-25LE ...
-
bioRxiv - Genetics 2019Quote: ... Xylenes (Sigma, #1330-20-7); RIPA (Biosesang ...