Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and 1.0% (v/v) phosphatase inhibitor cocktail #2 and #3 (Sigma-Aldrich P5726, P0044). Tissue homogenates were centrifuged at 14,000×g at 4°C for 20min and supernatants collected and stored at -80°C before initiating the protein assay.
-
bioRxiv - Synthetic Biology 2022Quote: ... The PCR products were transformed into pKM208 carrying Rosseta 2 (Millipore Sigma 71400-3) strain by electroporation ...
-
bioRxiv - Cell Biology 2022Quote: MCF10A cells (3×106 cells per condition) were fixed with 2% formaldehyde (Sigma, #252549) in PBS with 10% FBS for 10 min at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM Benzamidine) containing phosphatase inhibitor cocktail 2 and 3 (Sigma, P5726 and P0044). Supernatants containing proteins were collected after centrifugation at the highest speed for 15 minutes at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck ...
-
bioRxiv - Bioengineering 2024Quote: ... Amicon Ultra-0.5 (PLBC Ultracel-3 membrane, 3 kDa) and Amicon® Ultra-15 Centrifugal Filters (3 kDa MWCO) were from Millipore (Tokyo, Japan). Calcofluor-white and imidazole were from Sigma-Aldrich (Tokyo ...
-
bioRxiv - Immunology 2023Quote: ... 32 µM 5-(N-Ethyl-N-isopropyl)amiloride (EIPA) (Sigma Aldrich, #A3085), 5 mM 1-Heptanol (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by blocking for 1h at room temperature (5% Donkey Serum (D9663, Sigma) in 0.3% PBS-Tween (Tween 20 ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: ... Membrane was blocked for 1h in 5% BSA (bovine serum albumin, Sigma-Aldrich) in Tris-buffered saline with 0.1% Tween® 20 detergent (TBST ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Membranes were blocked (1h) with bovine serum albumin (5% wt/vol, Sigma-Aldrich) in Tris-buffered saline with Tween-20 (0.1%) ...
-
bioRxiv - Biophysics 2021Quote: ... Polymerization was induced by 5 µL of 10% ammonium persulfate solution (APS) (Roth) and 1.5 µL N,N,N’,N’-Tetramethylenediamine (TEMED) (Sigma Aldrich) (Roth) ...
-
bioRxiv - Neuroscience 2020Quote: ... NBQX (2 μg, Sigma, n=7), Bicuculline methiodide (0.05 μg ...
-
bioRxiv - Cell Biology 2021Quote: ... N’-methylenbisacrylamide (BIS, 2%, M1533, SIGMA), sodium acrylate (SA ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-mM N-ethylmaleimide (Sigma Aldrich) was added ...
-
bioRxiv - Microbiology 2023Quote: ... 2-amino-N-cholrophenyl)benzamide (Sigma), and sulfamethoxazole (TOKU-E ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μM 4-(N-Ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino) pyrimidinium chloride (ZD7288) (Sigma-Aldich), 10 μM 1-[2-[[(Diphenylmethylene)imino]oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochloride (NO711 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 6 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s incomplete adjuvant (Sigma-Aldrich) for the first boosting ...
-
bioRxiv - Cell Biology 2021Quote: To measure symplasmic connectivity using the HPTS (8-Hydroxypyrene-1, 3, 6-trisulfonic acid trisodium salt, SIGMA-ALDRICH) dye movement assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5 μM RA treatments on days 0 and 4 plus 10 nM BIO (6-Bromoindirubin-3’-oxime, Sigma) treatment on day 0 ...
-
bioRxiv - Microbiology 2022Quote: ... female 3–4-week-old BALB/c or C57BL/6 mice were injected intraperitoneally with 10mg azoxymethane (Sigma) per kg mouse weight ...
-
bioRxiv - Neuroscience 2023Quote: Five-month-old C57BL/6 mice (13/group; 10 male and 3 female) were administered dexamethasone (D2915, Sigma; 5mg/kg per day ...
-
bioRxiv - Biochemistry 2023Quote: ... The column was eluted using 6 mL of Strep-start buffer supplemented with 3 mM d-Desthiobiotin (Sigma). The elution was diluted with 20 mL of ion-exchange buffer (25 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 100 mg tablet of 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma A9941) was dissolved in 100 mL of citrate buffer (50 mM ...
-
bioRxiv - Biophysics 2020Quote: ... 1H,1H,2H,2H-perfluorooctyl-trichlorosilane (#448931, Sigma-Aldrich, Germany) vapor was deposited onto the developed master mold under vacuum to provide hydrophobic coating and ease the peel-off of the replicas ...
-
bioRxiv - Biophysics 2022Quote: ... silanized with trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma) vapor overnight under vacuum to facilitate subsequent release of PDMS from the template and avoid tearing the top cap of the cantilevers ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... the culture medium was supplemented with 3 μM or 5 μM SU5402 (Sigma-Aldrich, SML0443) before live imaging ...
-
bioRxiv - Bioengineering 2019Quote: ... and 0.5 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate (8-Br-cAMP; Sigma-Aldrich B5386) in EGM for 6 days [30–34] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) is added in ACSF to enhance the Ca2+ signals ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) was initially added in HBSS buffer to enhance baseline Ca2+ signals ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Kv7 channel activator retigabine (10−8 M to 3·10−5 M, Sigma). Some PAs were treated with XE991 (3·10-8-3·10-6 ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.5% NP-40 (Sigma) in PBS for 5 min ...
-
bioRxiv - Immunology 2024Quote: ... washed 3 times with PBS and blocked with 5% bovine serum albumin (Sigma Aldrich, A9647) in PBS for 1 h ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-5 kDa fluorescein isothiocyanate– dextran (FITC-dextran; 500 µg/ml, Sigma-Aldrich #FD4-100MG) was added to the culture media in the top channel ...
-
bioRxiv - Microbiology 2022Quote: ... all assays were scored after 6 days and included 5-fluoro-2’-deoxyuridine (FUdR; SIGMA) to prevent the appearance of the next generation of larvae that would complicate the experiments [55] ...
-
bioRxiv - Bioengineering 2022Quote: ... The nanopatterned flexible films were then washed with an amine-terminated poly(N-isopropylacrylamide) (pNIPAM) solution (13 µM in H2O, Mn = 2500 Sigma-Aldrich) for 24 hours on a tabletop rocker (55 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10 -8 to 3· 10 -5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
bioRxiv - Microbiology 2021Quote: ... glucose were pelleted by centrifugation and resuspended in 5 mL YNBNAG11 pH 5.1 containing 5 μM 3-MB-PP1 (EMD MILLIPORE) or DMSO as a vehicle control ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...