Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated for 24 h with 1 mM Deferiprone (DFP) (379409, Sigma Aldrich), an iron chelator that mimics hypoxic conditions through stabilization of the transcription factor HIF1α and subsequent upregulation of NIX and BNIP3 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were collected after 24 hours and RNA was extracted using TriReagent (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and 2.5% tert-amyl alcohol (240486, Sigma-Aldrich) and were intracardially perfused with pre-cooled 0.9% saline ...
-
bioRxiv - Microbiology 2024Quote: ... or 2 mM tert-butyl hydroperoxide (TBOOH, Sigma). Nunc 96-well EdgeTM plates (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... The AGA52 was grown in MRS broth (0.25% dextrose + 0.3% ox bile containing) supplemented with 100ppm cholesterol (5-cholesten-3β-ol (Sigma, Merck GmbH, Darmstadt, Germany), dissolved in 2-propanol ...
-
bioRxiv - Cell Biology 2024Quote: ... The medium was then changed to RPMI-1640/B27 minus insulin for 24 hours and switched to RPMI-1640/B27 minus insulin supplemented with 5 µM IWR-1 (Sigma-Aldrich, St. Quentin Fallavier, France) for 48 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were cultured in hypoxia and treated with 50µM 3-bromopyruvate (3-BP) (Sigma, 376817) dissolved in DMSO.
-
bioRxiv - Immunology 2021Quote: ... (3) TexMACS™ medium (Miltenyi) was supplemented with 3% heat-inactivated human AB serum (Sigma) and 1X Penicillin Streptomycin solution (TAC) ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Molecular Biology 2022Quote: ... home-made LIF conditioned medium and 2i inhibitors: 3 μM GSK-3 inhibitor XVI (Sigma) and 10 μM MEK inhibitor PD0325901 (Tocris)) ...
-
bioRxiv - Developmental Biology 2022Quote: Caspase 3 activity was measured using the Caspase-3 Colorimetric Activity Assay Kit (APT131, Millipore). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were placed into 1/3 Methanol and 2/3 dichloromethane (DCM, Sigma-Aldrich, 270997) with rotation at 13rpm at room temperature for overnight incubation ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 mins in phosphate-buffered saline (PBS) with 0.1% Tween-20 (both Sigma-Aldrich) and probed for 1 hour at room temperature in the dark with IRDye® 800CW conjugated goat anti-mouse secondary antibodies (LiCOR Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... shLmnA (produced in our lab), shLMNC (produced in our lab, 5′-TCTCCCACCTCCATGCCAAAG-3’) or shLMNB1 (Sigma clone NM_010721.1-956s1c1 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed and developed with chromogenic 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma-Aldrich, B6149).
-
bioRxiv - Physiology 2020Quote: ... and T3 (3,3’,5-triiodo-L-thyronine, > 95% HPCL, CAS number 6893-02-3, Sigma-Aldrich) were first dissolved in 0.1M NaOH and then diluted in 0.9% NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-5 μL of biliverdin hydrochloride (chromophore for iRFP signal activation, final concentration 0.002%, Sigma; 30891) added to cells and incubated for 10 mins at 37 °C before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Neuroscience 2020Quote: ... Then washed for 5 min x 3 times and blocked in 1% BSA (A3059, Sigma-Aldrich) (w/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were washed 3×5 minutes in TBST buffer and incubated with ChAT antibody (Sigma, AB144) at 1:100 dilutions overnight at 4°C in the blocking buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were allowed to differentiate for 5 days with differentiating media [3 μg/ml prolactin (Sigma, #L6520 ...
-
bioRxiv - Cell Biology 2022Quote: ... The reagents treated for some indicated experiments include: 3-5 µM oligomycin A (Sigma, Cat# 75351), 1 µM (for HeLa cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 μM of the PKA activator 8-Bromoadenosine 3’,5’-cyclic monophosphate (Sigma, dissolved in water) and without FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AGTTTCTCTGTCCGATTTAAA-3’] are in the plasmid backbone pLKO.1-CMV-tGFP and were from Sigma Millipore (St Louis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed with PBS 3 times and blocked with 5% normal donkey serum (Sigma-Aldrich) in wash buffer for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified protein 5-HT2C or HCA2 (3 μg) was immobilized on nickel agarose beads (Sigma) in the incubation buffer containing 50 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... and guanosine-5’-γ-3-thiotriphosphate (GTPγS) were acquired from Sigma-Aldrich (St. Louis, MO, USA). WIN 55,212-2 was purchased from Tocris Bioscience (Bristol ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Systems Biology 2024Quote: ... 8-Br cAMP (8-Bromoadenosine 3′,5′-cyclic monophosphate, final conc. 500 µM; Sigma B6386-100mg). In addition to stimulation for decidualization ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Cell Biology 2024Quote: ... The proteins were eluted in buffer 5 [buffer 3 plus 200 μM FLAG peptide (Sigma-Aldrich)] for 1.25 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Parasites were maintained at <3% parasitemia and routinely synchronized by treating with 5% sorbitol solution (Sigma) for ring stage and by using percoll gradient (Cytiva ...
-
bioRxiv - Neuroscience 2022Quote: ... and Mannitol (3 g of Bacto Peptone [Becton Dickinson], 5 g of Yeast Extract [Sigma-Aldrich] ...
-
bioRxiv - Bioengineering 2023Quote: ... All reaction mixtures contained 250 nM of sirtuin (SIRT1-3, 5 Reaction Biology, SIRT4,6,7 Sigma-Aldrich), 10 µM furimazine (Promega) ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were subsequently washed 3 x 5 minutes in PBST 0.01% (DPBS ThermoFisher, Tween P1379 Sigma), permeabilised for 15 minutes in PBST 0.5% and washed in PBST 0.01% a further three times ...
-
bioRxiv - Physiology 2024Quote: ... Samples were washed (3 times, 5 min each) with PBS containing 0.1% Triton X100 (Sigma-Aldrich), and then incubated with secondary antibody (Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... human Spindly siRNA (Sequence antisense: 5’-GAAAGGGUCUCAAACUGAA-3’, dTdT overhangs, Sigma-Aldrich, St. Louis, MO, USA), and control siRNA (D-001810-10-05 ...
-
bioRxiv - Physiology 2024Quote: ... tissues were washed (3 x 5 min) in PBS containing 0.1% Triton X-100 (Sigma-Aldrich) and incubated with mouse anti-TARDBP primary antibody or mouse anti-HuC/D (for total neurons ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3-(4,5-dimethylthiazolyl-2-yl)-2–5 diphenyl tetrazolium bromide (MTT, Sigma, St. Louis, Missouri, USA) was introduced ...
-
bioRxiv - Cell Biology 2024Quote: ... The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’) (NC, Sigma, St. Louis, MO, USA). A total of 60 nM siRNAs was used for transfection using Lipofectamine-RNAi-MAX Reagent (13778 ...
-
bioRxiv - Bioengineering 2024Quote: ... KG) followed by incubation in freshly made 5% (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, Cat. no. 440140) in deionized water for 20 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... Staining was detected with 5-bromo-4-chloro-3’-indolylphosphate/nitro-blue-tetrazolium (BCIP/NBT, Sigma).
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...