Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 9314 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The peptides formed from the digestion were further purified by C18 ZipTips (Millipore) and analyzed by LC-MS/MS ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were desalted and resuspended in 0.1% FA using C18 stage tips (Millipore). Digested samples (500 ng ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µg of tryptic peptides were loaded onto an Ascentis® (Sigma–Aldrich) ES-C18 column (2.1 mm × 100 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... Elution was performed by incubation of the beads with 3xFLAG peptide (Sigma Aldrich) at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the immunopurified complexes were eluted with 3X FLAG peptide (Merck Millipore/Sigma). For tandem IP experiment ...
-
bioRxiv - Cancer Biology 2023Quote: ... and nucleosomes were eluted by incubating the beads with 3xFLAG peptide (Sigma Millipore) at a concentration of 500 ng/μL in Buffer D for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... and nucleosomes were eluted by incubating the beads with 3xFLAG peptide (Sigma Millipore) at a concentration of 500 ng/μL in Buffer D for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were eluted with ABC buffer and then desalted with C18 tips (Millipore) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Bound complexes were eluted by incubation with 500 µg/mL 3xFLAG peptide (Sigma) for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted with 5 ml of 1 mg/ml Flag-peptide (Sigma), followed by the addition of 20 ml of QA buffer (50mM TRIS pH 7.7 ...
-
bioRxiv - Immunology 2024Quote: ... Peptides were desalted and resuspended in 0.1% FA using C18 stage tips (Millipore). Samples were analyzed in a timsTOF Pro with PASEF (Bruker Daltonics ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were desalted and resuspended in 0.1% FA using C18 stage tips (Millipore).
-
bioRxiv - Bioengineering 2024Quote: ... Digested peptides were then desalted using ZipTip according to the manufacturers protocol (Millipore). Desalted peptides were then eluted ...
-
bioRxiv - Cell Biology 2023Quote: ... and the excess peptide was depleted via Amicon Ultra Centrifugal Filters (Merck Millipore). To label the azide-coupled nanobody with a fluorophore ...
-
bioRxiv - Neuroscience 2024Quote: ... we pre-incubated this primary antibody with the GnRH1 peptide (L7134, Sigma-Aldrich) at increasing concentrations (1 ...
-
bioRxiv - Biophysics 2024Quote: ... and eluted with elution buffer containing 3X FLAG peptide (10 µg/ml, SIGMA) using gravity flow columns ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Bioengineering 2024Quote: ... Amicon Ultra-0.5 (PLBC Ultracel-3 membrane, 3 kDa) and Amicon® Ultra-15 Centrifugal Filters (3 kDa MWCO) were from Millipore (Tokyo, Japan). Calcofluor-white and imidazole were from Sigma-Aldrich (Tokyo ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by cysteine blocking for 10 minutes at room temperature using methyl methanethiosulfonate (MMTS, Sigma) at a final concentration of 10mM ...
-
bioRxiv - Cell Biology 2020Quote: ... and treated with FITC anti-mouse IgG antibody (F0257, Sigma; 1:1000 in blocking buffer) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and treated with FITC goat anti-mouse antibody (F0257, Sigma; 1:2000 in blocking buffer) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... antibodies we diluted in blocking solution with 0.01% Tween®20 (Sigma, St. Louis, MO) using rat monoclonal anti-HA 1:500 (Millpore Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were blocked for 30 minutes in PBT + 1x WBR (Western Blocking Reagent, Sigma, #11921673001) and then incubated overnight at 4°C with primary antibody (mouse anti-mNeonGreen [32F6] ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were immersed in the blocking solution composed of 10% dimethyl sulfoxide (Sigma-Aldrich 276855), 1X casein buffer (Vector ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by blocking solution containing mouse anti-α-actinin antibody (1:300, A7811; Sigma-Aldrich) for 60 min ...
-
bioRxiv - Systems Biology 2021Quote: ... Then cells were incubated in a blocking solution containing 10% bovine serum albumin (BSA, Sigma) and 0.01% Triton X-100 for 1h at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... in Tris-NaCl blocking buffer (1:5) or PBS containing 1 % BSA (Sigma Life Science) and 0.3 % Triton X 100 (Sigma Life Science) ...
-
bioRxiv - Neuroscience 2021Quote: ... Blocking was performed for 1h at RT using 20% normal goat serum (S26, Sigma-Aldrich) in Tris-NaCl blocking buffer (TNB) ...
-
bioRxiv - Neuroscience 2021Quote: ... Following blocking in 5% SureBlock reagent (LubioScience, Zurich, Switzerland) diluted in PBS-Tween20 (PBST, Sigma) for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... Ovaries were then blocked in 1X casein/PBSTX(0.1%) (stock: 10X casein blocking buffer, Sigma) for 30 min and incubated with rabbit anti-Egl primary antibody (kind gift from R ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... in blocking solution (2 % BSA (BBITM solutions, Crumlin, UK) in 10 mM TRIS (Sigma-Aldrich) buffer pH 7.4 containing 0.001% Triton-X100 (Calbiochem ...
-
bioRxiv - Biochemistry 2021Quote: ... PVDF membranes were incubated in 1X Casein blocking buffer (10X stock from Sigma-Aldrich, B6429) made up in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... we incubated the sections in blocking solution (1X PBS with 0.1% Triton X-100 (Sigma) and 10% normal goat serum (NGS ...
-
bioRxiv - Bioengineering 2020Quote: ... Antagonistic blocking of the AChR was achieved via 1mL bolus of 200µM d-tubocurarine (Sigma) to 1mL of surrounding basal medium (MM) ...
-
bioRxiv - Cell Biology 2021Quote: ... Blocking solution contained PBS supplemented with 10 % goat-serum (biowest) and 0.1 % Triton-X100 (Sigma). Primary antibodies were incubated for 2 hrs and secondary antibodies for 1 hr ...
-
bioRxiv - Cancer Biology 2022Quote: ... Following a 30-min blocking step with 2% BSA (bovine serum albumin) (Sigma-Aldrich #B4287) resolved in 1x PBS ...