Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 2317 citations for 8 Fluoranthenemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... was coated and the previously mentioned cytokines were added in combination with polybrene (8 µg/mL, Sigma-Aldrich). The latter was only used in case of lentiviral transduction and it was removed after 24 hours by replacing medium and cytokines ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-8 weeks old mice were intraperitoneal (i.p) injected with 200 mg/kg tamoxifen (TAM, Sigma-Aldrich, T5648) for 5 consecutive days ...
-
bioRxiv - Biochemistry 2019Quote: Clone 8 cells were grown on 10 cm plates in Shields and Sang M3 insect Medium (Sigma #S8398) supplemented with 0.5 mg/mL insulin (Sigma #I6634) ...
-
bioRxiv - Cancer Biology 2019Quote: ... F9 and WEHI-164 tumors was studied on ice-cold acetone-fixed 8-10μm cryostat sections stained with FITC labeled IgG(L19) (FITC_F7250 Sigma) (final concentration 2μg/mL ...
-
bioRxiv - Genetics 2019Quote: ... Target cells were transduced with the resulting lentiviruses in the presence of 8 μg/mL polybrene (Sigma-Aldrich). At 24 hrs after transduction ...
-
bioRxiv - Neuroscience 2019Quote: ... and cultured with and split 1:6 to 1:8 every four to five days using Accutase (Sigma). 10 µM ROCK inhibitor (Y-27632 ...
-
bioRxiv - Pathology 2020Quote: ... Male mice at 8-10-week old were intraperitoneally injected with Tamoxifen (1mg/kg, Sigma, St Louis, MO) for five consecutive days to induce Cre nuclear translocation and gene excision ...
-
bioRxiv - Cell Biology 2021Quote: To measure symplasmic connectivity using the HPTS (8-Hydroxypyrene-1, 3, 6-trisulfonic acid trisodium salt, SIGMA-ALDRICH) dye movement assay ...
-
bioRxiv - Developmental Biology 2019Quote: ... The viral supernatant was mixed with 8 μg/ml DEAE-dextran and 1000 units/ml ESGRO (Merck Millipore) and added directly to the E14tg2a cells ...
-
bioRxiv - Immunology 2020Quote: ... Culture media was replaced with retroviral supernatant supplemented with of 50μM BME and 8 μg/mL polybrene (Millipore), and cells were centrifuged for 60min at 2000rpm ...
-
bioRxiv - Synthetic Biology 2020Quote: ... adjusted to pH = 8 with 2 M NaOH and syringe-filtered (Millex® MP 0.22 μm, Millipore Sigma). Extreme caution was taken to prohibit contamination ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-8 dpf Islet2b:PA-GFP larvae were injected with BODIPY membrane dye (1nL of 1mg/mL; Sigma, D3821) into the space behind the right eye and underlying skin to demarcate retinal anatomy and facilitate subsequent targeting ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Each well of an 8-well chamber μ-slide was coated with 5 μg of fibronectin (F1141, Sigma) overnight at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... purchased from the listed manufacturers: the complex I inhibitors capsaicin (8-methyl-N-vanillyl-6-nonenamide, Sigma-Aldrich), dihydrocapsaicin (N-(4-Hydroxy-3-methoxybenzyl)-8-methylnonanamide ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates (20-40 μg) were subjected to 8-15% SDS-PAGE and transferred to nitrocellulose membranes (Millipore). The membrane was blocked using 5% milk in TBST buffer at room temperature for 1 h ...
-
bioRxiv - Physiology 2021Quote: ... Proteins were resolved by SDS-PAGE on 8% acrylamide gels and electrotransferred onto Immobilon P (Millipore, Bedford, MA). Then ...
-
bioRxiv - Physiology 2021Quote: ... Glycogen content was measured using the same kit following an 8 h amyloglucosidase (A9228, Sigma-Aldrich Canada Co.) digestion in a dark drawer at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... were transduced with inducible S TEMCCA and rtTA lentivirus-containing supernatants overnight in 8 μg/ml polybrene (Sigma). Doxycycline (2μg/ ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... twice with LiCl wash buffer (10 mM Tris-HCl [pH 8], 250 mM LiCl, 0.5% sodium deoxycholate, 1 mM EDTA, 0.5% IGEPAL CA-630 [Sigma]), and twice with 10 mM Tris-HCl [pH 8] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Zebrafish aged 8-9 months (adult) or 1 month (juvenile) were culled in high dose tricaine (Sigma Aldrich), immersed for 5 min in 1% Virkon (3S Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: Mouse of 5-8 weeks of age were injected intraperitoneally (IP) with 1 µg/g of Tunicamycin (Sigma) using 150 mM of D-Glucose as vehicle ...
-
bioRxiv - Cell Biology 2020Quote: Fixed cells were permeabilized using ice-cold Hi-C lysis buffer (10 mM TRIS-HCl pH 8 [Sigma] ...
-
bioRxiv - Cell Biology 2021Quote: ... filtered (0.45 μm) and used to infect target cells in the presence of 8 μg/mL polybrene (Millipore) at MOI < 1 ...
-
bioRxiv - Immunology 2021Quote: ... Concentrated lentiviral supernatants were used to transduce cells in the presence of 8 μg/ml Polybrene (Sigma-Aldrich), and infected cells were selected by FACS sorting and subjected to imaging experiments.
-
bioRxiv - Microbiology 2022Quote: ... Then 1 mL of lysis buffer (8 M Urea buffer, 50 mM NH4HCO3, phosphatase inhibitors (Sigma-Aldrich, P2745), and protease inhibitors cocktail (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 900 µL freshly prepared Urea buffer (10 mM HEPES pH 7.4, 1 mM EDTA pH 8.0, 8 M Urea (U4883, Sigma)) was added ...
-
bioRxiv - Microbiology 2022Quote: ... before transduction of TREx BCBL1-Rta cells in the presence of 8 μg/mL of polybrene (Merck Millipore). Virus supernatant was removed 6 hours post transduction and fresh media added ...
-
bioRxiv - Microbiology 2022Quote: ... Coronavirus OC43 (ATCC VR-1558) was propagated in HCT-8 cells and detected by antibody staining (MAB9012, Millipore).
-
bioRxiv - Developmental Biology 2022Quote: ... Single mESC clones were picked 7-8 days after transfection and plated onto 96-well synthemax (Sigma, #CLS3535) coated plates and screened for genomic DNA deletion by PCR using primers outside of the deletion region.
-
bioRxiv - Cell Biology 2022Quote: Adult (week 8) mice (Cx40-ChR2 and DbhCreERT/Rosa26-tdTomato transgenic mouse model) were injected with Tamoxifen (Sigma) (150 mg/kg ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 2 × 104 cells were cultured in an 8-well chamber slide (Merck Millipore, Massachusetts, USA) and then fixed with 4% paraformaldehyde in PBS buffer for 15 min at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... 6-8 week-old transgenic mice were injected daily intraperitoneally (ip) by a suspension of tamoxifen (Sigma-Aldrich) in corn oil (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: The epididymis isolated from 8-week-old mice and sperm allowed to swim into M16 medium (Sigma-Aldrich), which was maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... This mixture was left to incubate at RT for 10 minutes before adding 900 μl of freshly prepared Urea buffer (10 mM HEPES pH 7.4, 1 mM EDTA pH 8.0, 8 M urea from Sigma). The solution was then carefully inverted seven times before being centrifuged at RT for 30 min at 20000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... retroviral particles were directly added to U2OS cells in the presence of polybrene (8 μg/ml, Sigma-Aldrich). Twenty-four hours after infection ...
-
bioRxiv - Immunology 2023Quote: ... BDG (10 μg/ml glucan) and LPS (8 μg/ml derived from Escherichia coli 0111:B4, Sigma-Aldrich), or with anti-CD3 mAb (clone #2C11 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and a titration of trimethoprim (0, 1, 2, 4, 8, 16, 24, and 32 µg/mL) (Sigma Aldrich) with 0.4 % dimethylsulfoxide ...
-
bioRxiv - Microbiology 2023Quote: ... at which point 32.5 μL of a mixture containing an 8:5 ratio of 0.6 mM resazurin (Sigma) dissolved in 1X phosphate-buffered saline to 20% Tween 80 was added ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... specimens (n=8 from each group) were sacrificed using a lethal dose (400ppm) of tricaine (MS-222; Sigma) and immediately imaged under light microscopy at 20x before rigor mortis set in to maintain flexibility in the jaw joints ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies were diluted in 1% Tween in PBS or 5% Bovine Serum Albumin (Sigma, CAS # 9048-46-8) prepared in 1% Tween in PBS (filtered ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell pellets were lysed with 8 M urea supplemented with 1x HALT in 200 mM EPPS (E0276 Sigma) by pipetting up and down 10 times ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus containing media was added to ATG3 KO HeLa cells with 8 μg/mL polybrene (Sigma-Aldrich, H9268). After a day ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were seeded in 8 cm2 flasks hanging a microcentrifuge tube containing either 1 ml benzethonium hydroxide (Sigma) (for 14CO2 equilibration ...
-
bioRxiv - Biochemistry 2023Quote: ... and 8% D2O using a Millipore Amicon Ultra-15 Centrifugal Filter Ultracel-3K (Millipore #UFC900324, 3 kDa cutoff), concentrated to a concentration of 50 μM and transferred to an NMR tube after removal of any precipitates by centrifugation ...
-
bioRxiv - Bioengineering 2023Quote: ... whereas the viral particles present in the supernatant were concentrated with 8% PEG8000 (Polyethylene glycol 8000, Sigma-Aldrich) by precipitation (4000g ...
-
bioRxiv - Cell Biology 2023Quote: ... Spastin protein was resolved on 8% SDS-PAGE gels transferred to Immobilon®-FL PVDF membranes (Millipore; 05317) using a wet blot transfer system (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the primers KLB163 (AGACGCGGCCGCCGCGGGAGTACTTTACGGG ...
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the KLB161 (AGACGCTAGCGAACTTTTTTCTTCTAATTTTTTGA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4°C) and resuspended in B cell medium supplemented with 8 μg/mL polybrene (#TR-1003, EMD Millipore) at a density of 2×106 cells/mL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... These fragments were homogenized by placing them in 2.0 mL screw-cap tubes containing a single 3.0 mm and 8 1.5 mm stainless steel beads and shaking them in a BeadBugmicrotube homogenizer (#Z763713, Sigma) for 120 seconds at a speed setting 3500 rpm ...