Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... Acetoxymethyl Ester) (Sigma Aldrich, St. Louis, MO, USA) for 30 min in microscopy buffer at a final concentration of 1.25 µM ...
-
bioRxiv - Genetics 2020Quote: Cy3 Mono-Reactive NHS Ester (Millipore Sigma PA13105);
-
bioRxiv - Genetics 2020Quote: Cy5 Mono-Reactive NHS Ester (Millipore Sigma PA15101);
-
bioRxiv - Bioengineering 2023Quote: ... Atto488 NHS ester was purchased from Sigma-Aldrich. Alexa Fluor™ 647 NHS ester (succinimidyl ester ...
-
bioRxiv - Cell Biology 2023Quote: ... or Cy3 Mono NHS Ester (Sigma-Aldrich, GEPA13101) dye was dissolved in DMSO to make 1mg/ml stock solutions and then diluted with 0.1 M sodium bicarbonate solutions to a final concentration of 1 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Phorbol ester Phorbol 12,13-dibutyrate (PDBu) (Sigma-Aldrich) was used at concentration of 1 µM SUM159 cells were imaged with 1:100 Oxyfluor reagent (Oxyrase Inc. ...
-
bioRxiv - Biophysics 2024Quote: ... CF™ 750 succinimidyl ester (Sigma-Aldrich, USA) were prepared in DMF and stored at −20 °C and then diluted in different solvents just before measurements to a final concentration of around 500nM.
-
bioRxiv - Immunology 2024Quote: ... cells (1-2.5×105 cells/well) were stimulated with a pool of 18-amino acid peptides overlapping by 15 amino acids (Sigma Aldrich) spanning the Chlamydia muridarum CPAF S491A antigen (final concentration of 2.5μg/ml)27 on PVDF-membrane plates (Millipore ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Developmental Biology 2021Quote: Treated or untreated embryos were anesthetized at desired stages with 0.02% tricaine and mounted in 5% methyl cellulose (Sigma, Cat M-6385) for observation ...
-
bioRxiv - Plant Biology 2022Quote: ... Individual plants of similar size were transferred onto BCDATG agar (4-5 per plate) supplemented with NaCl or methyl viologen (Sigma-Aldrich, 856177) and incubated at 22±1°C with a 16h:8h light:dark cycle ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were washed with PBS (pH 7.4) and incubated in 10 ml PBS (pH 7.4) containing 5 mM catalyst 5-methoxyanthranilic acid (Sigma Aldrich) and the ligand coupled to HATRIC ...
-
bioRxiv - Neuroscience 2020Quote: ... FBS supplementation was decreased to 3% FBS 3 days prior to the addition of 10□M Retinoic Acid (RA; Sigma-Aldrich, R2625). During differentiation ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hrs followed by addition of 3 µM Asunaprevir (Apexio: BMS-650032) and 500 µM 3-Indoleacetic acid (Sigma Aldrich: I2886). Cells were treated with following inhibitors to inhibit indicated kinases ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7) gradient (20%, 40%, 60%, 80%, 100%), incubated 3 times (1h, o/n, 2h) in 100% dichloromethane (DCM) (Sigma-Aldrich, St. Louis, MO, USA) to remove hydrophobic lipids ...
-
bioRxiv - Neuroscience 2024Quote: ... brain sections were washed in phosphate buffer (PB) and incubated 1h in a solution containing equal volumes of 3% potassium ferrocyanide (Sigma-Aldrich, Ontario, Canada, cat# P9387) with 4% osmium tetroxide (EMS ...
-
bioRxiv - Biochemistry 2021Quote: ... 1:5 or 1:10 (v/v) ratio with sinapinic acid matrix (Sigma; 10 mg/mL in water/acetonitrile/trifluoroacetic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... in acetic acid (0.02 N) or human plasma fibronectin (5 µg/mL; Millipore) in PBS overnight at 4°C and rinsed with imaging medium to remove the coating solution ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 wt% poly-aspartic acid sodium salt (P3418, Sigma-Aldrich, Zwijndrecht, The Netherlands) was mixed into the dialyzed SF solution ...
-
bioRxiv - Neuroscience 2021Quote: ... ibotenic acid (5 μg/μL in saline; Sigma-Aldrich, St. Louis, MO, USA), AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (serotype AAV1 ...
-
bioRxiv - Pathology 2023Quote: ... samples were acidified with 5 μl of 10% trifluoroacetic acid (91719, Sigma-Aldrich), heated at 37 °C for 45 min and centrifuged 10 min at 17’000 x g ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated for 5 minutes in 0.5% Periodic Acid (Sigma Aldrich, 375810), rinsing wells twice in PBS ...
-
Maternal n-3 enriched diet reprograms neurovascular transcriptome and blunts inflammation in neonatebioRxiv - Neuroscience 2024Quote: ... mixed with 5 μl of 100 mM ethylenediaminetetraacetic acid (EDTA, ED2P, Sigma-Aldrich) and centrifuged to obtain blood plasma for further analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 mg/mL ascorbic acid (A0278-25G; Sigma, St. Louis, MO, USA); and
-
bioRxiv - Biophysics 2022Quote: ... 5 μl 40× Protocatechuic acid (PCA; cat. no. 37580-25G-F - Sigma-Aldrich), 4 μl 50× Trolox (cat ...
-
bioRxiv - Microbiology 2022Quote: ... Digestion was finally stopped by adding 5 μL of formic acid (Sigma-Aldrich) and the Eppendorf tubes were centrifuged at 10000 g during 5 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-inch round silicon wafers were etched using 48% hydrofluoric acid (Sigma, 695068). The etched wafer was then washed with water ...
-
bioRxiv - Immunology 2024Quote: ... γδ T cells were stimulated with either 5 μM zoledronic acid (Sigma-Aldrich) or 10 μg/mL plate-bound αPan-γδ TCR antibody (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2024Quote: ... non-essential amino acids and 2 × 10−5 M 2-ME (Sigma-Aldrich).
-
bioRxiv - Microbiology 2023Quote: ... The guide and target strands (Table S4) were labelled with Cy5 Mono NHS Ester and Cy3 Mono NHS Ester (Sigma-Aldrich), respectively ...
-
bioRxiv - Microbiology 2023Quote: ... spike-RBD polyclonal antibody (catalog no: 40592-T62. Sinobiological, US) was activated with dibenzylcyclooctyne-NHS ester (DBCO-NHS ester, Sigma Aldrich) at room temperature (RT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the ‘anti-handle’ oligonucleotide was linked to the peptide: the amine-modified oligonucleotide was reacted with Dibenzocyclooctyne-N-hydroxysuccinimidyl ester (DBCO-NHS ester; Millipore, #761524) in phosphate buffer pH 8.0 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The coiled-coil peptide was first attached to an oligonucleotide using DBCO-Azide copper free click chemistry: The amine-modified oligonucleotide was reacted with Dibenzocyclooctyne-N-hydroxysuccinimidyl ester (DBCO-NHS ester; Millipore, #761524) in phosphate buffer pH 8.0 overnight ...