Labshake search
Citations for Millipore Sigma :
1251 - 1300 of 10000+ citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-mGluR2/3 (1:50 dilution, EMD Millipore, #AB1553, RRID AB_90767); rabbit anti-mGluR7 (1:100 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... IBMX (3-isobutyl-1-methylxanthine) and Cilostamide were purchased from Sigma-Aldrich.
-
bioRxiv - Biochemistry 2021Quote: ... Phosphatase Inhibitor Cocktail 3 (1:100 dilution of commercial stock, Sigma-Aldrich), and NaF (10mM) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μg ml-1 α-factor mating pheromone (Sigma, custom peptide WHWLQLKPGQPMY) was added every hour (a total of three additions ...
-
bioRxiv - Bioengineering 2020Quote: ... for 1 hour and then adding 3 µM propidium iodide (PI) (Sigma) for additional 40 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-fibulin-3 antibody (1:100, Chemicon Millipore, #MAB1763, St. Louis, MO), anti-fibulin-3 antibody (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 1:3 ratio (w/w) in DMEM (Sigma-Aldrich, D6429) without supplements ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-isobutyl-1-methylxanthine (IBMX) was purchased from Sigma (Cat #I5879-1G), dissolved in DMSO to 100mM stock ...
-
bioRxiv - Microbiology 2022Quote: ... Two concentrations (1 µg/ml & 3 µg/ml) of mitomycin C (Sigma) were independently added into the flasks ...
-
bioRxiv - Neuroscience 2023Quote: ... acid-sensing ion channel 3 (guinea pig anti-ASIC3, Millipore; 1:2000), S100β (rabbit anti- S100β ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% v/v of phosphatase inhibitor cocktail 3 (Sigma-Aldrich #P0044). After 30-minute lysis on ice ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nthy-ori 3-1 cell line (source: female) was purchased from Sigma and was part of the European Collection of Authenticated Cell Cultures ...
-
bioRxiv - Immunology 2023Quote: ... washed 3 times with PBS and stained with 1% crystal violet (Sigma) for 30 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: Cas1 and cas2/3 genes were subcloned into pRSFDuet-1-MCS1 (Novagen) and pGEX6p-1 (Novagen) ...
-
bioRxiv - Biochemistry 2023Quote: ... concentrated to ∼1 mL with the 3 kDa cutoff spin filter (Millipore). Untagged γ-TuNA was then further purified over a HiLoad 16/600 Superdex 75 column pre-equilibrated in gel filtration buffer (40 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was infiltrated using 3:1 acetone to Durcupan resin (Sigma Aldrich) for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... and glyceraldehyde 3- phosphate dehydrogenase (GAPDH; G8795, Sigma Aldrich at 1:5000) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted to 1:2000 in 3% normal donkey serum (Millipore Sigma, S30) and 0.3% Triton-X ...
-
bioRxiv - Cancer Biology 2022Quote: ... Migrated cells were fixed with 3% paraformaldehyde (PFA) + 1% glutaraldehyde (Sigma-Aldrich) for 15 minutes and GFP positive cells were counted using Leica DMi8 (Leica Microsystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was infiltrated using 3:1 PO to Durcupan resin (Sigma-Aldrich) for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was infiltrated using 3:1 acetone to Durcupan resin (Sigma Aldrich) for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... with 3-(trimethylsilyl)-1-propanesulfonic acid sodium salt (DSS, 178837, Sigma Aldrich) as internal standard ...
-
bioRxiv - Genomics 2024Quote: ... Cells were blocked for 1 hour using 3% BSA (Sigma-Aldrich, #A7906) in PBST (Tween-20 in 1x PBS ...
-
Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-viral hsa-miR-132 ProcessingbioRxiv - Molecular Biology 2024Quote: ... added 3 µL of 1M7 (1-methyl-7-nitroisatoic anhydride (Sigma-Aldrich); i.e. ...
-
bioRxiv - Immunology 2024Quote: ... or equine sera were incubated 1:3 with receptor- destroying enzyme (Sigma) overnight at 37 °C followed by heat inactivation at 56 °C for 30 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... and mounted on glass slides in 8:3:1 chloralhydrate (Sigma-Aldrich) solution ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-RNA binding Fox-1 homolog 3 (NeuN, Sigma, HPA030790, RRID) and goat anti-doublecortin (DCX ...
-
bioRxiv - Genomics 2024Quote: ... A gel solution containing 3% 19:1 acrylamide:bis-acrylamide (Sigma Aldrich, A3449) in 1xTBS with 0.1% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 1% Insulin-Transferrin-Selenium (ITS)+3 (Sigma-Aldrich, Cat: I2771), 40µg/ml L-Proline (Life Technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 mM MgCl2 in PBS 1× (all acquired from Sigma-Aldrich). The fixation process comprised three steps ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 mM MgCl2 in PBS 1× (all acquired from Sigma-Aldrich). The fixation process was conducted in three stages ...
-
bioRxiv - Zoology 2020Quote: ... 3-methyl-but-2-enyl acetate and (2E)-hex-2-enyl acetate were confirmed with analytical standards from Sigma-Aldrich (St. Louis, MO). For the analysis of CHCs ...
-
bioRxiv - Biophysics 2023Quote: ... different amounts of freeze dried GelMA macromer were dissolved in DPBS containing 0.5% (w/v) 2-Hydroxy-4’-(2-hydroxyethoxy)-2- methylpropiophenone (Sigma-Aldrich) as photoinitiator ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) for 15 min at RT ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...