Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... human AC16 cells (Millipore) were cultured in DMEM/F12 supplemented with 10% FBS and either 6% D2O (heavy labeled population ...
-
bioRxiv - Cancer Biology 2024Quote: ... human insulin (Sigma # I0516) was added at a final concentration of 0.01mg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... human transferrin (#T8158, Sigma), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC #P0673) ...
-
bioRxiv - Immunology 2024Quote: Human AB serum (Millipore) was diluted 1/10 to a final volume of 200 mL in ice-cold PBS + 0.1% Tween 20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human E2F1 shRNA (Sigma): TAACTGCACTTTCGGCCCTTT ...
-
bioRxiv - Microbiology 2021Quote: ... Cleared lysates were loaded on chromatographic columns filed with His-select resin (Millipore Sigma) or glutathione resin (GE healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Ni-NTA pull down was conducted by using HIS-Select Nickel Affinity Gels (Sigma). After lysing cell pellet with buffer A (6 M guanidine-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... HIS-tagged B subunit of Shiga toxin 1(SML0655) and Apilimod (A149227) from Sigma; rabbit anti-EEA1 (#3288) ...
-
bioRxiv - Plant Biology 2020Quote: ... The pET-26-tNPR1-His plasmid was then transformed into Rosetta (DE3) pLysS (Novagen). The overnight culture at 37°C was transferred to fresh LB medium containing 50 μg/mL kanamycin and was incubated to OD600=1.0 at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and the supernatant was applied to a HIS-Select Nickel Affinity Gel column (Sigma) equilibrated in lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... and the supernatant was applied to a HIS-Select Nickel Affinity Gel column (Sigma) equilibrated in lysis buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibody (Anti-His; Invitrogen, Waltham, MA or Anti-HA; Sigma Aldrich, St.Louis, MO) was added to the blocking solution at 1:2,000 dilution and incubated overnight at 4 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... and the subsequent western blot analyses were performed with anti-His (Sigma, Missouri, USA) or anti-FLAG antibody (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% (v/v) HI-FBS and 1% (v/v) antibiotic/antimycotic (Sigma) in a standard tissue culture incubator at 37 °C with 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... The lysate was mixed gently with 50% Ni-NTA His-bind slurry (EMD Millipore) at 4:1 ratio on a shaking platform for 60 minutes at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... and the supernatant was incubated with 6 ml HIS-Select Nickel Affinity Gel (Sigma), gently agitated at 4°C for 1 h ...
-
bioRxiv - Immunology 2020Quote: ... BM cells were cultured in growth media supplemented with 10% HI FBS (Sigma-Aldrich), 1% Pen/Strep (Lonza) ...
-
bioRxiv - Bioengineering 2022Quote: ... and mVenus-SpyCatcher-6×His were prepared using Gibson assembly with pET-19b (Novagen) as the plasmid vector ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Mpp75Aa1.1 or Mpp75Aa1.1-His was mixed with high purity pepsin (Sigma, St. Louis, MO) in 2 mg/ml NaCl ...
-
bioRxiv - Biochemistry 2024Quote: ... and dilutions were as follows (in parenthesis): His (mouse, Sigma cat# H1029; 1:2,500); β-actin (rabbit ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% heat-inactivated Fetal Bovine Serum (FBS-hi; Sigma, Cat. no. F7524), 1% antibiotic-antimycotic (AA ...
-
bioRxiv - Microbiology 2024Quote: ... and supplemented with 10% fetal bovine serum (FBS-HI) (Sigma, Cat. No: F9665-500ml). The cells were incubated at 37°C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Clarified lysate was applied to buffer equilibrated His-select Cobalt affinity gel (Sigma-Aldrich). Eluted protein was collected and dialysed overnight against 4 L of dialysis buffer (Table S2 ...
-
bioRxiv - Bioengineering 2024Quote: ... HI HS with cerivastatin (25 nM or 75 nM in ddH2O; Cat. #SML0005; Sigma) or HI HS with 1 mg/ml of healthy ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant insulin human (≥ 98%), somatostatin-14 (≥ 97%, human HPLC grade), and urocortin-3 (≥ 97%, human HPLC grade) were all purchased from Sigma-Aldrich. Taxonomy will only be indicated for insulin ...
-
bioRxiv - Bioengineering 2023Quote: ... human iPSC-derived cardiomyocytes were suspended in fibrinogen from human plasma (Sigma-Aldrich) at a concentration of 50x106 cells/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... human iPSC-derived cardiomyocytes were suspended in fibrinogen from human plasma (Sigma-Aldrich) at a concentration of 50x106 cells/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... C-terminal tags were removed by incubation overnight at 4° C with Thrombin (Sigma). Thrombin was removed by passage over benzamidine agarose beads ...
-
bioRxiv - Biochemistry 2020Quote: ... C-terminal tags were removed by incubation overnight at 4° C with Thrombin (Sigma). Thrombin was removed by passage over benzamidine agarose beads ...
-
bioRxiv - Cell Biology 2021Quote: ... Atg18 was isolated by affinity purification using the Gly6-FLAG3 tag and Dynabeads (Sigma) crosslinked with the FLAG M2 antibody (F1804 epitope ...
-
bioRxiv - Microbiology 2020Quote: PfaF (locus tag: PBPRA0221) was cloned into pET28 as an NheI-XhoI fragment (Novagen) as to generate N-terminal 6xHis tagged protein ...
-
bioRxiv - Microbiology 2021Quote: ... The results were analyzed by immunoblotting using antibodies for the Flag tag (SIGMA, SLCD6338).
-
bioRxiv - Cell Biology 2022Quote: ... FTractin cDNA was fused with Halo tag in pTriEx-4 vector (Millipore Sigma, MA). EGFP was swapped with mEos3.2 41 in the cortactin-EGFP vector to obtain cortactin-mEos3.2 ...
-
bioRxiv - Physiology 2023Quote: ... TAG levels were then measured using the Serum Triglyceride Determination Kit (TR0100-1kt, Millipore) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a C-terminal His6-tag was cloned into the expression vector pET21b (Novagen). The MALT1(PCASP-Ig3)339–719-his construct was transformed into Escherichia coli strain T7 express competent cells ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... TAG content was quantified using the High Sensitivity Triglyceride Assay Kit (Sigma-aldrich MAK264), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... These antisense DNA probes were synthesized with Biotin-TAGs at the 5’ ends (Sigma) and 100 µM probes were pooled in equimolar ratios ...
-
bioRxiv - Immunology 2023Quote: ... Monoclonal ANTI-FLAG® M2 antibody used in Cut&Tag assay was from Sigma. Mouse CD4 T Cell Isolation Kit used for the enrichment of CD4+ T cells was from Stem cell ...
-
bioRxiv - Biochemistry 2023Quote: ... REC114 variants were cloned as N-terminal Strep-tag fusions into pRSFDuet-1 (Novagen) and co-expressed with MEI41-127 that was cloned as a His-tag fusion into pProEXHTb (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 2h with antibodies recognizing the FLAG-tag (F-1804; Sigma-Aldrich), Strep-tag (NBP2-41073 ...
-
bioRxiv - Physiology 2023Quote: TAG and total cholesterol evaluation were processed according to the manufacturer’s instructions (Sigma-Aldrich, MAK266 for TAG and Cell Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... the GST tag was then removed by addition of 20μL thrombin (Millipore 69671-3), and the sample was cleaved at 4°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... The V5 epitope tag was detected using mouse monoclonal anti-V5 antibodies (Sigma-Aldrich) and HRP-conjugated goat anti-mouse IgG (Bio-Rad laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... and retinal levels of human Pi and serum levels of human insulin were measured using human Pi and human insulin ELISA kits (EZHPI-15K and EZHI-14K, respectively; Millipore, Darmstadt, Germany) according to the manufacturer’s instructions and as described previously (Isiegas et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... the iBMECs were seeded in the vascular channel at a density of 16 x 106 cells/ml using iBMEC seeding medium (human serum-free endothelial cell medium supplemented with 5% human serum from platelet-poor human plasma (Sigma, Cat.# P2918) and allowed to attach to the membrane overnight (the bottom side of the chip was facing up during this period) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-amyloid precursor protein (APP; mouse anti-human monoclonal antibody clone 22c11, dilution 1:10, epitope retrieval time 10 min, MAB348; EMD Millipore, Burlington, MA, USA); anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Microbiology 2021Quote: ... sBHI media controls or Porphyromonas cell-free supernatants (240 µg of total protein) were incubated with 120 µg of human fibrinogen (Sigma-Aldrich, St. Louis, MO). Reaction mixtures were incubated at 37°C under anaerobic conditions or in an atmosphere of 5% CO2 for cell suspension or cell-free supernatants ...
-
bioRxiv - Plant Biology 2020Quote: ... using either 0.5 μg of recombinant histone H3 (Millipore, Cat. #14-411), 2 μg of chicken core histones (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 U DNA recombinant Taq polymerase in buffer (pH= 8.0; Sigma, Germany), 1x PCR buffer (pH=8.7 ...