Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for Methyl 2 chloro 3 trifluoromethyl benzoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... followed by cysteine blocking for 10 minutes at room temperature using methyl methanethiosulfonate (MMTS, Sigma) at a final concentration of 10mM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Thawed sperm was preincubated for 30 minutes in TYH (with Methyl-b-cyclodextrin, Sigma C4555) medium at 37 deg C ...
-
bioRxiv - Microbiology 2020Quote: ... washed with tap water and stained with methyl crystal violet solution (0.2% v/v) (Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 g of (0.42 mmol) N-α-acetyl-L-lysine methyl ester HCl (Sigma Aldrich) and 10 mL of ultrapure water ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... zebrafish larvae were anaesthetised in PBS containing 0.02 % aminobenzoic-acid-ethyl methyl-ester (MS222, Sigma), as described (Tsarouchas et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Mannose inhibition: biotinylated HHL was incubated with methyl mannose (200 mM; 30 min, RT; Sigma) prior to HHL staining.
-
bioRxiv - Cancer Biology 2021Quote: L-leucyl-L-leucine methyl ester (L7393) and Bafilomycin A1 (B1793) were purchased from Sigma and used at 1mM concentration and 100nM respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... and treated with 40 mM methyl-β-cyclodextrin (Sigma C4555; 5-10 mins on ice) to sequester fatty acids ...
-
bioRxiv - Immunology 2021Quote: ... the IDO1 pathway inhibitor D-1-methyl-tryptophan (D-1MT or indoximod, 2mg/mL, Sigma) or control saccharin water was given to mice in bottles protected from light beginning on day 8 ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 μM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (678937, Sigma, UK) and 8 mM ascorbic acid (A15613 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed 1x in PBS followed by treatment with 10mM methyl-ß cyclodextrin (Sigma), 1mM water-soluble cholesterol (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... The retention time was locked using standard mixture of fatty acid methyl esters (Sigma Aldrich).
-
bioRxiv - Bioengineering 2022Quote: ... The lipase from porcine pancreas and methyl cellulose (viscosity 25 cp) were obtained from Sigma Chemical Co ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCN2iB used for animal studies was formulated in 0.5% Methyl Cellulose (Sigma-Aldrich, Cat. #M0262) containing 5% DMSO ...
-
bioRxiv - Biochemistry 2020Quote: ... high-performance liquid chromatography (HPLC)-grade tert-butyl methyl ether (t-BME, Sigma-Aldrich, #34875), HPLC-grade acetonitrile (FUJIFILM Wako ...
-
bioRxiv - Cell Biology 2020Quote: ... 400 μM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (678937, Sigma, UK) and 8 mM ascorbic acid (A15613 ...
-
bioRxiv - Neuroscience 2021Quote: ... was dissolved in vehicle solution containing 98% methyl cellulose Tylose (Sigma Aldrich, Zwijndrecht, the Netherlands) and 2% Tween80 (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... Peaks were identified using a bacterial fatty acid methyl esters (BAME) mix (Sigma Aldrich, UK) and quantified using a 37-component fatty acid methyl esters (FAME ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified using a 37-component fatty acid methyl esters (FAME) mix (Sigma Aldrich, UK). The biomass of each group of microorganisms was determined using the combined mass of fatty acids to which the group is attributed in Table S2.
-
bioRxiv - Microbiology 2023Quote: ... phosphate-citrate buffer with sodium perborate and Methyl-α-D mannose were purchased from Sigma. Lentil lectin resin ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with the muscarinic antagonist scopolamine methyl nitrate (1mg/kg s.c., Sigma Aldrich) to reduce the peripheral effects of PILO ...
-
bioRxiv - Cell Biology 2022Quote: Solvents for lipid extraction were tert-butyl methyl ether (HPLC grade, Sigma-Aldrich, 34875-1L) and methanol (HPLC grade ...
-
bioRxiv - Neuroscience 2024Quote: ... Lipids were extracted with 600 µl ice-cold methyl tert-butyl ether (MTBE, Sigma-Aldrich) and 150 µl methanol (VWR) ...
-
bioRxiv - Microbiology 2023Quote: ... (v) methyl viologen (MV) solutions: MV solutions were prepared by diluting MV (Sigma, 10 mM) directly into the media of choice.
-
bioRxiv - Biochemistry 2023Quote: ... the substrate-free solution was supplemented with N- methyl-D-glucamine (NMDG) hydrochloride (Sigma-Aldrich) at the same concentration to avoid interference with the Ag/AgCl reference electrode ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by derivatization with 70μl of N-tert-Butyldimethylsilyl-N- methyl-trifluoroacetamide (Sigma-Aldrich, 394882) for 1 hour at 70 °C ...
-
bioRxiv - Cell Biology 2023Quote: We determined exopher sensitivity of animals to acute oxidative stress using paraquat (methyl viologen, Sigma). We transferred L4 animals to freshly prepared NGM plates containing paraquat 200 mM and assessed percent survival after an overnight exposure.
-
bioRxiv - Physiology 2024Quote: ... the femurs were immersed in infiltration solution made of 85% destabilized methyl methacrylate (MMA, Sigma), 15% dibutyl phthalate (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Column-bound proteins were washed in Binding buffer and methyl tert-butyl ether (MTBE, Sigma), and then digested with 5 µg of trypsin (Promega ...
-
bioRxiv - Cell Biology 2024Quote: 1mM Leu-Leu methyl ester hydrobromide (LLOMe) (Sigma-Aldrich, L7393-500MG, CAS: 16689-14-8), 200 μM Chloroquine (Sigma-Aldrich ...
-
bioRxiv - Zoology 2024Quote: ... and N-methyl-N-(tert butyldimethylsilyl) trifluoroacetamide (MTBSTFA) were purchased from Sigma-Aldrich (Supelco, 98.5%).
-
bioRxiv - Biochemistry 2024Quote: ... N-succinyl-Leu-Leu-Val-Tyr-7-amido-4-methyl coumarin (Sigma, Massachusetts, USA; S6510). A final concentration of 100 nM proteasome and 100 μM proteasome peptide substrate was prepared in the reaction buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...