Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Molecular Biology 2024Quote: ... SC medium without histidine was prepared with 20 mM 3-amino-1,2,4-triazole (3-AT) (Sigma-Aldrich), unless otherwise specified ...
-
bioRxiv - Biophysics 2024Quote: ... epoxysilane was deposited by submerging slides in toluene doped with 3-glycidyloxypropyl-trimethoxymethylsilane (3-GPS, Millipore-Sigma) for 20 min ...
-
bioRxiv - Biophysics 2024Quote: ... epoxysilane was deposited by submerging slides in toluene doped with 3-glycidyloxypropyl-trimethoxymethylsilane (3-GPS, Millipore-Sigma) for 20 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and YL-36 (Sigma Aldrich, cat no. SML2834) or the LDDs CC3240 and CC3756 were added to the NK cell cultures immediately after plating.
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Diflufenican (N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]-3-pyridinecarbox-amide) was purchased from Sigma-Aldrich (Taufkirchen, Germany). Diflufenican metabolites AE B107137 (2-[3-(Trifluoromethyl)phenoxy]nicotinic acid ...
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... organoid sections were washed twice for 3 minutes each with 3% bovine serum albumin (BSA) (Millipore Sigma # A2153) dissolved in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... at a concentration of 1.5 mM was sonicated in nanopore water with 3 mM lactic acid (Sigma-Aldrich, L1750, St. Louis, MO) and sterilized via passage through a 0.2 μm filter ...
-
bioRxiv - Synthetic Biology 2021Quote: To induce the degradation of mAID-fused proteins, cells were treated with 500 µM indole-3-acetic acid (auxin, IAA, dissolved 500 mM in water) (Millipore Sigma, I5148) for 1 hour ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... at a concentration of 1.5 mM was sonicated in nanopore water with 3 mM lactic acid (Sigma-Aldrich, L1750, St. Louis, MO) and sterilized via passage through a 0.2 μm filter as described in (5) ...
-
bioRxiv - Cell Biology 2021Quote: ... Oocytes were surgically removed from anesthetized frogs (40, 46) under anesthesia (2 g/L Tricain, 3-aminobenzoic acid ethyl ester, Sigma A-5040). Preparation of defolliculated oocytes was carried out as described in (106) ...
-
bioRxiv - Genomics 2021Quote: ... The dried samples were reconstituted using a buffer solution (0.1% formic acid: acetonitrile = 97:3) and was then filtered through a 0.45 μm centrifuge filter (Millipore; 1 min, 13,000 rpm). The supernatant was then transferred to a 96-well collection plate ...
-
bioRxiv - Genomics 2021Quote: ... cells were first washed once with phosphate-buffered saline (PBS) and supplemented with equilibrated (37 °C and 5% CO2) medium containing 500 μM indole-3-acetic acid (Sigma-Aldrich, I5148) freshly prepared before use ...
-
bioRxiv - Plant Biology 2023Quote: ... 4-day old Col_0 seedlings were incubated with LRC liquid medium supplemented with indicated concentrations of compounds (Adenosine 5′-triphosphate magnesium salt, ATP-Mg [VWR]; Abscisic acid, ABA [Sigma-Aldrich]; Carbonyl cyanide 3-chlorophenylhydrazone, CCCP [Sigma-Aldrich] ...
-
bioRxiv - Cell Biology 2024Quote: ... and ABTS substrate solution (water containing 0.54mg/mL w/v 2’2-Azinobis (3-ethylbenzthiazoline Sulfonic Acid) diammonium salt (Sigma-Aldrich, Cat#A-1888), and 0.1M Citric Acid and 0.03% v/v Hydrogen Peroxide (H2O2) ...
-
bioRxiv - Cell Biology 2023Quote: ... H3.3 K36M or cells overexpressing histones were continuously grown in the presence of 50μM Indole-3-acetic acid (IAA) (Sigma-Aldrich, I5148-2G) until experiments were performed to suppress protein expression ...
-
bioRxiv - Biochemistry 2022Quote: ... using the absorbance measurement of 2,2′-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) substrate at 405 nm (Sigma Aldrich Catalog # 11468120910).
-
bioRxiv - Bioengineering 2022Quote: ... cell-seeded wells (n=3 per group) were rinsed with PBS and incubated in 500 μL of 5% trichloroacetic acid (TCA, Sigma-Aldrich, T6399) in UPW for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... Auxin induced degradation of RAD21-AID-mClover in the HCT116 + Rad21-mAC cells was performed by adding 500uM 3-Indoleacetic acid (IAA, auxin) (Sigma, 45533-250MG) dissolved in 100% Ethanol ...
-
bioRxiv - Biochemistry 2022Quote: ... were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt, Aldrich) or negatively charged 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS, Sigma-Aldrich, Inc) containing N,N’-methylenebisacrylamide (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... and stained for 15 minutes in Alcian Blue solution (1% Alcian Blue in 3% solution of acetic acid) (Cat. # A5268, Sigma Aldrich, UK). Slides were then washed in running tap water for 2 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...