Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for PD 1 Human C93S HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... human Glu-Fibrinopeptide B (Sigma-Aldrich) was recorded throughout the analysis for lock-mass calibration ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Neuroscience 2024Quote: ... Insulin solution human (Sigma Aldrich, I9278);
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-human P2RY12 (Sigma, HPA014518), rabbit anti-human PU.1 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2024Quote: ... 10 % human AB serum (Sigma-Aldrich), and 10 ng/ml recombinant human macrophage colony stimulating factor (Peprotech ...
-
bioRxiv - Cancer Biology 2024Quote: ... raised against human ST3GAL1 (Sigma HPA040466) and ST3GAL2 (Abcam ab96028) ...
-
bioRxiv - Bioengineering 2024Quote: IgG from human serum (Sigma-Aldrich) was incubated at 62°C for 30 min to induce aggregation ...
-
bioRxiv - Bioengineering 2024Quote: ... or human complement C1q (Sigma-Aldrich) were immobilized on a CM5 or C1 sensor chip (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 mg/mL human fibrinogen (Sigma), 10% Matrigel (Corning) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% human serum albumin (Sigma-Aldrich), 0.0002% heparin (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: ... by overnight dialysis or using a PD-10 Column (Cytiva, Marlborough, MA) (mGluR3) and concentrated as necessary using 3K MWCO Amicon Ultra Centrifugal filters (Millipore Sigma, Darmstadt, Germany) at 10°C ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cells were seeded in 6-well plates (3.0 × 105 cells/well) coated with poly-L-lysine (Sigma-Aldrich, St. Louis, MO, USA) and incubated for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then, wildtype HEK293 cells (ATCC, CRL-1573) were infected in regular growth medium with 5 µg/mL polybrene (Sigma-Aldrich, TR-1003-G) and the lentivirus at a multiplicity of infection of 5 viral particles per cell ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 mM tris (2-carboxyethyl) phosphine (TCEP) and P8849 Protease Inhibitor Cocktail for His-tagged proteins (Sigma). The lysate was cleared at 25.000 × g for 30 min at 4°C and the supernatant was loaded on Protino®Ni-TED 2000 packed columns and purified as described by the manufacturer (Macherey-Nagel ...
-
bioRxiv - Cancer Biology 2021Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2×YT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... blotted onto nitrocellulose and the proteins were detected with an anti-His antibody (Sigma-Aldrich, Steinheim, Germany). To test whether 6His-PBBem1 and Cdc11 can bind simultaneously to Cdc24428-854 ...
-
bioRxiv - Biochemistry 2019Quote: ... Lysates were then added directly to 96-well His-Select Ni-NTA resin filter plates (Sigma Aldrich) and processed off-robot by centrifugation ...
-
bioRxiv - Biochemistry 2021Quote: Genes for His-tagged or Strep II-tagged nanobodies were cloned into the pET 26b vector (Novagen). The expression and purification of all His-tagged nanobodies have been described previously 12 ...
-
bioRxiv - Microbiology 2020Quote: ... and the supernatants were independently applied to a column of HIS-Select Nickel Affinity Gel (Sigma-Aldrich) equilibrated with 50 mM sodium phosphate buffer ...
-
bioRxiv - Biophysics 2021Quote: ... followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma). Further purification was performed by ion exchange chromatography (Source Q for WT and the S897E ...
-
bioRxiv - Biophysics 2020Quote: ... and passed through pre-equilibrated HIS-Select Ni-nitrilotriacetic acid resin (Ni-NTA) (Sigma-Aldrich Co., USA) at 4 °C for binding of 6x-His tagged protein ...
-
bioRxiv - Cell Biology 2019Quote: ... The His-tag was removed by cleavage with 16 U of thrombin (Ref 27-0846-01, Sigma) added directly onto the beads for 2h at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... pneumoniae LicB with an N-terminal 10×His affinity tag in a modified pET-19b vector (Novagen) was overexpressed in E ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... plasmid coding for 6x-His-Cas9 were transformed in Rosetta DE3 Novagen competent cells (Merck Millipore, USA). Protein production was induced using autoinduction medium (Formedium ...
-
bioRxiv - Cell Biology 2020Quote: ... in the presence or the absence of 10 μg N-terminal-His-tagged ubiquitin (Sigma-Aldrich, #U5507), and ≈ 2 μg of purified recombinant mouse GST-Trim39 (WT ...
-
bioRxiv - Biophysics 2021Quote: ... The His-eluent was concentrated using a 30 kDa cutoff Amicon Ultra-4 centrifugal filter (Millipore UFC803008), filtered using a 0.22 μm Millex-GP PES membrane (Millipore SLGP033RS) ...
-
bioRxiv - Immunology 2022Quote: ... the 6x HIS tag region of the recombinant protein was removed following the vector manufacturers specifications (Novagen). This recombinant SmCI-1 was used to generate a rabbit anti-Sm-CI-1 polyclonal antibody using the Custom pAb service offered by Genscript.
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Biochemistry 2023Quote: ... After several rounds of washing with His-AC washing buffer (supplemented with 0.1% Tween-20 (Sigma Aldrich), 0.1% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2xYT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Genetics 2023Quote: ... imidazole was removed from the eluted His-SIRT5 using ultra-0.5 centrifugal filter units (UFC501096, Merck Millipore). 500 µl of the recombinant SIRT5 elution fractionation was added to the ultra-0.5 centrifugal filter units and centrifuged at 14,000 x g for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Immunology 2020Quote: ... plasma samples were incubated at a dilution of 1:100 and bound antibodies were detected with goat anti-human IgM/HRP (Sigma: cat. A6907, 1:6’000 dilution), goat anti-human IgG/HRP (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293-T cells were transiently transfected with GFP-V5 or GREP1-V5 fusion proteins using OptiMem and Fugene HD (Sigma-Aldrich, St. Louis, MO). 72 hours after transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Media were collected from HEK293 cells 48 hours after transfection and used for transductions in a final concentration of 8 ug/mL polybrene (Sigma-Aldrich, cat. TR-1003). Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... and human embryonic kidney 293 (HEK293) cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM (D5796, Sigma-Aldrich, St. Louis, MO), which was supplemented with 10% FBS (12676029 ...
-
bioRxiv - Cell Biology 2023Quote: ... to validate the gene expression the plasmid (vide-supra) was transfected into HEK293 cells using PEI (Sigma-Aldrich/Merck Cat. No. 49553-93-7) following an optimized version of the standard protocol(Rajendra ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... tccagagaagcctaaagtgat) or non-targeted control (shCont, Cat: SHC002) were generated in HEK293 cells using the Sigma Mission system (Sigma-Aldrich, St. Louis, MO USA). HUVECs were seeded into a 6-well dish at a density of 80,000 cells per well ...
-
bioRxiv - Biophysics 2021Quote: ... Micropatterned coverslips were functionalized with a solution of 10 µg mL-1 FN from human plasma (Sigma Aldrich #F1056) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... solutions of 89Zr-labeled TDM1 (4 μCi/μg) were prepared in PBS (pH 7.5) containing 1% w/v human serum albumin (HSA, Sigma) and 0.1% w/v sodium azide (NaN3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1×105 ESCs were plated on a 3.8 cm2 plate coated with human plasma fibronectin (Millipore, cat. no. FC010) and cultured in N2B27 medium supplemented with 12 ng/ml bFGF (R&D Systems ...
-
bioRxiv - Cancer Biology 2019Quote: The AsPC-1 and Capan-2 human PC cell lines were obtained from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Fisher (Waltham ...
-
bioRxiv - Neuroscience 2019Quote: ... the eye cup was treated for ∼ 15 minutes with human plasmin (∼ 50 µg mL−1, Sigma or Haematologic Technologies) to aid vitreous removal.
-
bioRxiv - Bioengineering 2020Quote: ... Three sections at varying depths within the tumor are immunostained with mouse anti-human nuclei (clone 235-1, Millipore) followed by secondary Dylight 488 horse anti-mouse (Vector) ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies to the N protein was detected by incubation for 1h at 37°C with anti-human IgG peroxidase (1:30,000, Sigma). The plates were washed three times with PBS with 0,05% Tween-20 between each step ...
-
bioRxiv - Microbiology 2021Quote: ... THP-1 (ATCC® TIB-202™) human monocyte cell line was cultured in RPMI-1640 medium (Sigma, R8758) supplemented with 10% FBS ...