Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for 2' Methyl 3 phenylpropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2 hours with blocking buffer (3% donkey serum in 0.1 M PBS; Sigma-Aldrich). Primary antibodies (ChAT ...
-
bioRxiv - Neuroscience 2022Quote: ... Internal solutions also contained 3-5mg/mL (0.3%-0.5%) of biocytin (Sigma-Aldrich, CAS# 576-19-2) which was added the day of recording.
-
bioRxiv - Systems Biology 2022Quote: ... The virus was collected both 2 days and 3 days later and 0.45 μm syringe filters (Millipore) were used to eliminate cells ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were washed 3 times in PBS before addition of 2% Triton X–100 (Sigma-Aldrich) PBS solution to lyse the cells for enumeration of the intracellular bacteria ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... phosphatase inhibitor cocktail 2 (P5726) and 3 (P0044) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and Doxorubicin (Adriamycin ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Cell Biology 2024Quote: ... DLD1 cells were treated for 2 h with 0.5 mM 3-indoleacetic acid (Sigma, stock in ethanol). At the time points indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... after 2-3 months of receiving HFD the mice were given 75 mg/kg STZ (Sigma-Aldrich) in 0.1M sodium citrate buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... After that cells were treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-.Aldrich) in a 1:10 ratio in a culture medium and incubated at 37 °C for 3 h ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2023Quote: ... 3-week-old plant leaves were infiltrated with 50 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Millipore-Sigma) in 50 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Cancer Biology 2023Quote: 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 KP cells (n=3) were plated in 6-well plates overnight in RPMI medium (Sigma). After 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... Patch pipettes (resistance 2-3 MΩ) were filled with an intracellular solution containing (mM): 110 CsMeSO3 (Sigma), 4.6 MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: Cell viability was determined by adding 0.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma) substrate to cells and subsequent incubation at 37 °C and 5% CO2 for 1–2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Cancer Biology 2024Quote: Glass coverslips of 20×20 µm are coated with silane (2% (3-Trimethoxysil) propyl-methacrylate (Sigma #M6514)) ...
-
bioRxiv - Cancer Biology 2024Quote: Cell viability was assessed using colorimetric MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay following by the manufacturer’s instructions (Sigma). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Physiology 2024Quote: ... A 3:2 dilution of Oil Red O filtered solution (0.5 g/100 mL isopropanol; Sigma-Aldrich) was added to cells and incubated for 5 minutes at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, USA). Sequencing grade modified Trypsin (Trypsin ...
-
bioRxiv - Neuroscience 2024Quote: ... Figure 3 used 2 µL of 30 µm polystyrene beads (Polystyrene beads 30 µm, 84135, Millipore Sigma)mixed with NGM buffer solution to fully capture moving C ...
-
bioRxiv - Bioengineering 2024Quote: ... was added to the PEG solution followed by the addition of 1- [bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... Monomer solution (1xPBS, 2 M NaCl, 8.625 % (w/w) Sodium acrylate (97 %, 744-81-3, Sigma Aldrich), 2.5 % (w/w ...
-
bioRxiv - Biochemistry 2024Quote: Samples for NMR spectroscopy were prepared by dissolving pectin (2–3 mg) in D2O (99.9% D, Sigma) with 60 nmol DSS-d6 (99% D ...
-
bioRxiv - Biophysics 2024Quote: ... The cantilever and CS were then washed with acetone and silanized with 2% 3-aminopropyltriethoxysilane (Millipore Sigma) in acetone for 30 minutes at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 methylcholanthrene (3-MC; Sigma-Aldrich), contained in DMEM with a final concentration of 0.1% of dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... 3-deazauridine (3-DU) (Sigma Aldrich) was used as a non-selective inhibitor of CTPS1 and CTPS2.
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Developmental Biology 2021Quote: Cells were loaded with 10 nM of the Nernstian probe tetramethylrhodamin methyl ester perchlorate (TMRM, Sigma), prepared in N2B27 media ...
-
bioRxiv - Physiology 2020Quote: ... mice were injected intraperitoneally with α-methyl-p-tyrosine (250 mg/kg α-MPT; Sigma-Aldrich), an active competitive inhibitor for TH ...
-
bioRxiv - Immunology 2021Quote: ... 5-A-RU was synthesised as described previously (120) and combined with methyl-glyoxal (Sigma-Aldrich) immediately before addition to the culture ...
-
bioRxiv - Biochemistry 2020Quote: ... Ethereal alcoholic solutions of diazomethane were prepared from N-methyl-N-nitroso-p-toluenesulfonamide (Sigma-Aldrich). All samples were extracted with tert-methyl butyl ether and mixed with 50 μL of diazomethane solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... prior to derivatization with 20µL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) at 60°C for 1 hour ...
-
Neural interactions in developing rhythmogenic spinal networks: Insights from computational modelingbioRxiv - Neuroscience 2020Quote: ... Locomotion was evoked by bath application of N-Methyl-D-aspartic acid (NMDA, 7 μM, Sigma) and serotonin creatinine sulfate monohydrate (5-HT ...
-
bioRxiv - Microbiology 2021Quote: ... Monosaccharides were then converted in methyl glycosides by heating in 1 M methanol-HCl (Sigma-Aldrich) for 16 hours at 80°C ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by a second incubation in 20 μL of N-methyl-N-(trimethylsilyl)-trifluoroacetamide (SIGMA, USA) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a density of 20k cells/well 24h prior to treatment with methyl-methanesulfonate (MMS; Sigma) and indicated PARP inhibitors ...
-
bioRxiv - Biochemistry 2022Quote: ... The retention time was locked using a standard mixture of fatty acid methyl esters (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... Methyl-β-cyclodextrin (Mβ-CD) and other reagents were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise specified ...
-
bioRxiv - Bioengineering 2022Quote: Dodecyl-modified (hydroxypropyl)methyl cellulose (HPMC-C12, made from USP-grade HPMC (hypromel-lose, Sigma-Aldrich)) and poly(ethylene glycol)-block-poly(lactic acid ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cholesterol-Water Soluble (Cholesterol–methyl-β-cyclodextrin, #C4951) and Trolox (#238813) were purchased from Millipore Sigma. Equal numbers of isogenic DIPG-007 ...
-
bioRxiv - Microbiology 2021Quote: ... washed with tap water and then stained with methyl crystal violet solution (0.2% v/v) (Sigma) and plaques were counted ...