Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Blocking was performed at room temperature for 2 hours with 3% BSA (Sigma-Aldrich) PBS-Tween ...
-
bioRxiv - Bioengineering 2024Quote: ... Amicon Ultra-0.5 (PLBC Ultracel-3 membrane, 3 kDa) and Amicon® Ultra-15 Centrifugal Filters (3 kDa MWCO) were from Millipore (Tokyo, Japan). Calcofluor-white and imidazole were from Sigma-Aldrich (Tokyo ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... the culture medium was supplemented with 3 μM or 5 μM SU5402 (Sigma-Aldrich, SML0443) before live imaging ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Developmental Biology 2022Quote: ... inflorescences from 3-week-old plants were treated with 5 μM 6-BA (Sigma-Aldrich), 50 μM IAA (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.5% NP-40 (Sigma) in PBS for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-5 kDa fluorescein isothiocyanate– dextran (FITC-dextran; 500 µg/ml, Sigma-Aldrich #FD4-100MG) was added to the culture media in the top channel ...
-
bioRxiv - Biophysics 2024Quote: ... were activated for 5 min with a solution of 3-(Trimethoxysilyl)propyl methacrylate (Sigma-Aldrich, 440159 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 500 µg/ml N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (dbcAMP, Sigma). Cells were used for experiments up to passage 8 ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 1.944 and 3.888 g, Sigma) were added to the mixture under stirring to activate 10 and 20 % of the carboxylic acid groups of the alginate ...
-
bioRxiv - Synthetic Biology 2024Quote: Synthetic xanthommatin (Xa) was synthesized from 3-hydroxy-DL-kynurenine (3-HK, Sigma-Aldrich) using potassium ferricyanide (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10 -8 to 3· 10 -5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
bioRxiv - Microbiology 2021Quote: ... glucose were pelleted by centrifugation and resuspended in 5 mL YNBNAG11 pH 5.1 containing 5 μM 3-MB-PP1 (EMD MILLIPORE) or DMSO as a vehicle control ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Cell Biology 2024Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10–8 to 3·10–5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
bioRxiv - Biochemistry 2024Quote: ... overnight at 4°C and then incubated for 3 hrs to overnight in 5% non-fat milk or 5% bovine serum albumin (Sigma) in TBS-T with primary antibodies against MPC1 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were washed with PBS and 3-(4,5-dimethyl-2-thiazolyl)2,5-diphenyl-2-H-tetrazolium bromide (MTT, Sigma-Aldrich) solution (final concentration ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated with 50 µL of a 2 mg/mL solution of (3-(4,5-dimethyl-thiazole-2-yl)-2,5-biphenyl tetrazolium (MTT, Sigma-Aldrich) in PBS for 4 h and then exposed to 100 µL dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 × 107 apoptotic cells were incubated with 3 U of DNase I or 2 U of proteinase (Sigma-Aldrich) in PBS at 37°C for 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: For multiphoton microscopy kidneys were fixed in 4% paraformaldehyde overnight at 4 °C and embedded in 3% low-melting point agarose (Sigma- Aldrich). Sections (500 µM ...
-
bioRxiv - Immunology 2022Quote: ... 10 µl of hemolymph was mixed with 90 µl of 3, 4-Dihydroxy-L-phenylalanine (L-DOPA, 4 mg/ml)(Sigma Aldrich) dissolved in nuclease free water (Cytiva) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cleared biopsies were blocked for 3–4 h at room temperature (RT) or overnight at 4°C in blocking buffer (PBS (Sigma-Aldrich), 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Plant Biology 2023Quote: ... Supernatants were incubated for 3-4 h at 4 °C with 15-20 μL of ANTI-FLAG® M2 Affinity Gel (Sigma) and washed 3-4 times with Co-IP wash buffer containing 0.1% Triton-100 but without Phosphatase Inhibitor Cocktails and Protease Inhibitor Cocktail ...
-
bioRxiv - Immunology 2024Quote: ... The filtered supernatant was then concentrated using a centrifugal filter unit with a 3 kDA cutoff at 4°C (Amicon Ultra-4 Centrifugal filters, Millipore, USA). Concentrated supernatant was stored in 200 µL aliquots at −80°C until further analysis.
-
bioRxiv - Cell Biology 2020Quote: ... Cyanine 3 (NC, Sigma-Aldrich) was used as a control of transfection efficiency.
-
bioRxiv - Developmental Biology 2021Quote: ... 3-bromopyruvate (Sigma Aldrich #16490) or 2-deoxy-D-glucose (CARLROTH #CN96.3 ...
-
bioRxiv - Developmental Biology 2021Quote: The drug 3’-dA (Sigma) was dissolved in M16 medium (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked with 3% BSA (Sigma) in PBS for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 3×FLAG peptide (F4799, Sigma), Expi29™ expression medium (A1435101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 min (3–18, Sigma) after homogenization by a 5 ml glass-glass douncer (Braun ...