Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Nuclear DNA was stained with DAPI (4’,6’-diamidino-2-phenylindole) (0.1 µg/ml; Sigma-Aldrich, Poland). Immunostained cultures were mounted on glass slides in ProLong Gold antifade medium (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... nuclei were counterstained with 500 ng/mL of 4′,6-diamidino-2-phenylindole (DAPI, Sigma, CAT#D8417) for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were stained with DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich Corp., St. Louis, MO, USA) and cover slipped with Fluoromont-G ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were washed 1x and incubated with 0.2µg/mL DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) for 10min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were stained using 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma Aldrich-Aldrich, Catalog No-D9542).
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with DAPI (4’,6-diamidino-2-phenylindole) (0.1 ng/μL, Sigma-Aldrich, cat. # D9542) for 5 min to exclude dead cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1x in wash buffer containing 0.1 μg/ml 4′,6-Diamidino-2-phenylindole dihydrochloride (Millipore Sigma, D8417), and 1x in wash buffer for 5 min each ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with the nuclear dye 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, Germany) and actin filaments were labeled with ATTO 647-phalloidin conjugate (Hypermol EK ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-8 weeks-old mice were intraperitoneally injected with 0.1mL of 10mg/mL 4-hydroxytamoxifen (Sigma Aldrich) dissolved in a solution of DMSO ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 mM 4-methylumbelliferyl N-acetyl-β- D-glucosaminide-6-sulfate (HEXA; Sigma Aldrich, MS, USA) in 0.1 M citric acid/NaOH buffer (pH 4.4 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... homogenates were stained with the fluorescent DNA marker 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich), its volume was determined using an Eppendorf Xplorer 5–1000 μL electronic pipette (Eppendorf ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were left to dry completely before being mounted with 6 µl of Mowiol 4-88 (Sigma) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and finally resuspended in FACS buffer containing 0.1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI, Sigma). Data collection occurred on a BD Biosciences LSRFortessa 3 and a gating strategy was used to isolate live ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were stained with 4’,6-diamidino-2-phenylindole (DAPI; 0.5 μg/ml, Sigma-Aldrich, cat# D8417) diluted in PB to label cell nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed thrice in PBS and incubated with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma, #D9542) diluted 1:10,000 in PBS for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... A 0.02 mg/mL solution of sulfosuccinimidyl 6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, 803332, Sigma) was prepared in anhydrous DMSO ...
-
bioRxiv - Bioengineering 2024Quote: ... Nuclear staining was performed through incubation of 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, D8417) diluted 1:250 in PBS ...
-
bioRxiv - Immunology 2024Quote: ... dead cell exclusion was achieved by the addition of 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) immediately before acquisition ...
-
bioRxiv - Cancer Biology 2024Quote: ... The nuclei were finally counterstained with DAPI (4’, 6-diamidino-2-phenylindole, Sigma-Aldrich, St. Louis, USA) and the sections were mounted ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... embryos were treated at shield stage (6 hours post-fertilization (hpf)) with 4-OHT (Cat#H7904: Sigma) from preheated (65°C for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 1.944 and 3.888 g, Sigma) were added to the mixture under stirring to activate 10 and 20 % of the carboxylic acid groups of the alginate ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treated with 1 μM 4-hydroxy-tamoxifen (4-OHT; Sigma-Aldrich) and 1 μM Shield1 (Clontech lab ...
-
bioRxiv - Neuroscience 2024Quote: ... 1-4 µM carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; Sigma #C2920-50MG), and 0.5 mM of rotenone (Sigma #R8875-25G ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Plant Biology 2024Quote: ... 6% v/v Triton X-100 (EMD Millipore #TX1568-1) added by pipetting for a final concentration of 1% TX-100 ...
-
bioRxiv - Physiology 2024Quote: ... or acetylated Tubulin (T7451, clone 6-11B-1; Sigma-Aldrich ) at 4° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Then primary mouse monoclonal antibody 6-11B-1 (Millipore Sigma) diluted 1:50 followed by secondary rat-absorbed Alexa 568-conjugated donkey anti-mouse antibody (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... Sildenafil (6 µg•g-1 body weight; PHR1807, Millipore Sigma) versus vehicle (volume matched injection ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mouse acetylated-tubulin (6-11B-1, Sigma-Aldrich), mouse anti-mouse γ-tubulin (GTU-88 ...
-
bioRxiv - Microbiology 2024Quote: ... and 6-Chloropurine riboside (99%, Sigma-Aldrich 5399-87-1) were formulated in DMSO for testing at 125 μM and 250 μM ...
-
bioRxiv - Immunology 2024Quote: ... Alexa Fluor 488 anti-acetylated tubulin (6-11B-1; Sigma), Alexa Fluor 488 DNAse 1 (Invitrogen) ...