Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 4589 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Cells were blocked in human blocking buffer (5% human serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were blocked in human blocking buffer (5% human serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: ... or 100% C3-depleted human serum (C3-depleted serum, human; Millipore Sigma) for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... human Akt1 (Sigma-Aldrich) or 0.3 μg active ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified human ApoA1 (Sigma) or purified ApoA1-ApoM protein was resuspended in PBS (10:1 mol/mol ...
-
bioRxiv - Systems Biology 2020Quote: ... human (GluFib, Sigma Aldrich) was added (0.3 ng/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... recombinant human apoE4 (Sigma), and ThT (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... human fibronectin (Sigma-Aldrich) 5 µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... human serum (H2918, Sigma), DMXAA (D5817 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human IgG (Sigma), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... human insulin (I9278, Sigma), human TGFβ1 (PHP143B ...
-
bioRxiv - Cell Biology 2022Quote: ... or human fibronectin (Sigma). We found that BSA and collagen IV coating both resulted in reliable cell adhesion ...
-
bioRxiv - Immunology 2022Quote: ... Pooled human serum (Sigma) dilutions and pooled saliva were prepared in a 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma), Penicillin-Streptomycin ...
-
bioRxiv - Microbiology 2022Quote: Human fibrinogen (Millipore Sigma) was resuspended in PBS at 1 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... + 10% human serum (Sigma) + 2mM L-glutamine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human fibrinogen (Sigma-Aldrich) labeled with fluorescent Alexa Fluor 647 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma) and 50% virus solution in RPMI media (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... Human AB serum (Sigma), recombinant IL-2 ...
-
bioRxiv - Cell Biology 2022Quote: ... with human fibronectin (Sigma) 10 μg/ml for 2h at room temperature under a laminar flow hood ...
-
bioRxiv - Bioengineering 2024Quote: ... human laminin (Sigma-Aldrich) and polyethylene glycol diacrylate (PEGDA ...
-
bioRxiv - Cell Biology 2024Quote: ... Human AB serum (Sigma) was used to prepare unstimulated cells or FCS (Biosera or Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... human serum (H2918, Sigma), Zymosan (Z4250 ...
-
bioRxiv - Biochemistry 2022Quote: ... human serum (Sigma-Aldrich), trypsin (Promega) ...
-
bioRxiv - Bioengineering 2023Quote: ... human recombinant LIF (Millipore), and Heparin (StemCell Technologies) ...
-
bioRxiv - Biochemistry 2024Quote: ... human AC16 cells (Millipore) were cultured in DMEM/F12 supplemented with 10% FBS and either 6% D2O (heavy labeled population ...
-
bioRxiv - Cancer Biology 2024Quote: ... human insulin (Sigma # I0516) was added at a final concentration of 0.01mg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... human transferrin (#T8158, Sigma), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC #P0673) ...
-
bioRxiv - Immunology 2024Quote: Human AB serum (Millipore) was diluted 1/10 to a final volume of 200 mL in ice-cold PBS + 0.1% Tween 20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human E2F1 shRNA (Sigma): TAACTGCACTTTCGGCCCTTT ...
-
bioRxiv - Cell Biology 2024Quote: ... recombinant human (AG968, Sigma). The information for all other reagents is indicated in corresponding sections.
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 2 ml of each recipient and donor strains were combined (three mating pairs in total) and filtered through sterile 0.22 µm membranes (Merck Millipore, GSWP02500), which were incubated over TSA plates for 8 days at 22°C ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions that strongly reacted with both antibody pairs were pooled and concentrated using a 10 kDa Ultra-15 centrifugal filter (Millipore-Sigma).
-
bioRxiv - Genomics 2021Quote: ... The resulting sheared chromatin fragments in a size range between 200 to 500 base pairs were incubated with H3K27me3 (Millipore #07-473,1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... cinnamon) or a pair of pure monomolecular odorants (ethyl butyrate, valeraldehyde, isoamyl acetate, ethyl tiglate, hexanone or cineole, Sigma-Aldrich). Pure odorants were diluted 1:10 in 10mL mineral oil and natural odorants were presented in their native state ...
-
bioRxiv - Cell Biology 2024Quote: For each genotype five salivary gland pairs from wandering 3rd instar larvae were dissected in PBS and immediately transferred into RIPA buffer (Sigma) plus protease inhibitors (cOmplete ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant insulin human (≥ 98%), somatostatin-14 (≥ 97%, human HPLC grade), and urocortin-3 (≥ 97%, human HPLC grade) were all purchased from Sigma-Aldrich. Taxonomy will only be indicated for insulin ...
-
bioRxiv - Genetics 2020Quote: ... Cells were spun down and resuspended in fresh SC-Dex media containing 24 nM alpha factor (Millipore-Sigma). Cells were incubated at 30°C for 2 hours to induce arrest in G1 phase.
-
bioRxiv - Genetics 2020Quote: ... Cells were spun down and resuspended in fresh SC-Dex media containing 24 nM alpha factor (Millipore-Sigma). Cells were incubated at 30°C for 2 hours to induce arrest in G1 phase.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-alpha smooth muscle actin (αSMA) (1:250, Cat. No A5228, Sigma-Aldrich, St. Louis, MO, USA). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-alpha smooth muscle actin (αSMA) (1:2000; Cat. No A5228, Sigma-Aldrich, St. Louis, MO, USA), goat anti-CCN2/CTGF (1;500 ...
-
bioRxiv - Neuroscience 2021Quote: ... as indicated: antibody against phospho-alpha synuclein (p-aSyn, S129; 81A monoclonal; EMD Millipore, #MABN826; dilution 1:1000)(46) ...
-
bioRxiv - Immunology 2020Quote: ... and the protein was eluted with MES wash buffer supplemented with 500 mM methyl-alpha-D-mannopyranoside (Sigma). The protein was buffer exchanged into phosphate buffered saline by successive rounds of centrifugation and stored at −80°C.
-
bioRxiv - Genetics 2020Quote: ... log phase cells (OD600~0.5 - 0.6) with bar1Δ were arrested in late G1 phase using 50 ng/ml alpha-factor peptide (Sigma) for ~120 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Tomatidine HCl (≥ 95%) and alpha-solanine (≥95%) standards were purchased from Sigma-Aldrich (St. Louis, MO, United States).
-
bioRxiv - Neuroscience 2024Quote: ... Absolute and relative activity for the full 24-hour recording and 12-hour periods were also calculated for six different frequency bands (i.e., SWA 0.5-5 Hz, Theta 5-9 Hz, Alpha 9-12 Hz, Sigma 12-16 Hz ...
-
bioRxiv - Biochemistry 2023Quote: As in previous study [31] Aspergillus oryzae alpha-amylase (EC 3.2.1.1) and potato starch were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Incubation with primary antibodies (anti-NvNrxnα3-1 -1:1000; anti-alpha-tubulin - 1:1000 (Sigma Aldrich, cat. T6074)) was performed overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... All primers were synthesized by Sigma-Aldrich (St. Louis, USA) and purified by HPLC ...