Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 8389 citations for 9 3 bromophenyl 9 phenyl 9H fluorene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... SD-Leu-Trp-His+1mM 3-AT (3-aminotriazol, Sigma) and SD-Leu-Trp-His-Ade (Formedium).
-
bioRxiv - Developmental Biology 2022Quote: ... The reaction was developed using 3-3’-Diaminobenzidine (DAB) (Sigma). For CLASP1 immunostaining ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Immunology 2020Quote: ... E-64 and 3-Methyladenine (3-MA) were from Sigma. Necrostatin-1 was from Abcam ...
-
bioRxiv - Immunology 2024Quote: ... 3-nitropropionic acid (3-NP, several doses, Sigma Aldrich N5636), Atpenin-A5 (several doses ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Sigma Aldrich #39391), and 3NPH solutions were mixed ...
-
bioRxiv - Neuroscience 2023Quote: ... (3) the PDE4B inhibitor A33 (3 mg/kg, Sigma-Aldrich), (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Glycogen Synthase Kinase 3 (GSK3) inhibitor CHIR99021 (3 μM) (Millipore) and Leukaemia-Inhibitory Factor (LIF ...
-
bioRxiv - Plant Biology 2024Quote: ... in the presence of 3-aminotriazol (3-AT) (Sigma-Aldrich). Quantitative interaction assays were performed in liquid medium by quantifying β-galactosidase activity as previously described (Hernández-García et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... 3% BSA (Sigma), 0.3% Sodium azide (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (Sigma Aldrich). For the immunofluorescence staining of freshly extracted zfPGCs ...
-
bioRxiv - Microbiology 2020Quote: ... 3% milk (Sigma). Primary antibody detecting ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% BSA (Sigma) and 0.1% Tween-20 (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mixture (Sigma). Cell lysates were then centrifuged at 15000×g for 20 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Relaxin-3 (Sigma), prostaglandin E2 (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 3% BSA (Sigma) in TBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 3% BSA (Sigma)) for 30 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... 3% sucrose (Sigma) and 0.8% (w/v ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 (Sigma-Aldrich). Documentation was performed with an Axioskop 2 mot plus (Zeiss ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Sigma-Aldrich) and eosin Y (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3% BSA (Sigma), 0.5% triton X100 (Sigma) ...
-
bioRxiv - Immunology 2024Quote: ... 3% BSA (Sigma), 1.2mM Calcium Chloride ...
-
bioRxiv - Pathology 2024Quote: ... 3% BSA (Sigma), 0.5% Triton X-100 (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sph2-YM4271 cells were grown on synthetic dropout (SD)-His media supplemented with the inhibitor 3 mM 3-amino-1,2,4-triazole (3-AT; Sigma). All Y1H effector plasmids were separately transformed into the Sph2-YM4271 reporter strain and plated on SD/-Leu plates ...
-
bioRxiv - Cancer Biology 2020Quote: ... The antibody reaction was visualized with 3-3’ diaminobenzidine (Sigma, D8001) followed by counterstaining with hematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... prior to being rinsed and reacted using 3-3’diaminobenzidine (Sigma) as chromagen ...
-
bioRxiv - Biochemistry 2021Quote: ... and 3’,3’c-di-AMP were purchased from Sigma-Aldrich, 2’,3’-cGAMP ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Plant Biology 2022Quote: ... and crosslinked using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma). Biotin-labelled probes were hybridized with sRNAs on the nylon membrane and stabilized streptavidin-horseradish peroxidase was used to detect the biotin signal.
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT, Sigma). Selection plates were left for 8 days at 30°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... activated with 250mM 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma)/ N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Systems Biology 2024Quote: ... or 3-bromopyruvate (3-BP; Sigma-Aldrich, St. Louis, MO; 16490) were added to their respective wells ...
-
bioRxiv - Systems Biology 2024Quote: ... 5µM 6-bromoindirubicin-3-oxime / GSK-3 inhibitor (Sigma, 361550-1MG) and 100 µg/ml Primocin (InVivogen ...
-
bioRxiv - Biophysics 2024Quote: ... 15 mM 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (Millipore Sigma E6383), 5 mM N-hydroxysuccinimide (NHS ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Neuroscience 2024Quote: ... antibodies were diluted in a 3% BSA in PBS and either 3% normal goat serum or 3% normal donkey serum (Millipore-Sigma) depending on the secondary antibody host species ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...