Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 6 aminonaphthalene 1 3 disulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and treated with 1 % pluronic acid (Sigma-Aldrich; P2443-250g) in PBS for one hour at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 g/l monosodium glutamic acid (MSG) (Sigma-Aldrich, G1626), 2 g/l amino acid mix SC(MSG)-Ura (glutamic acid replaced by MSG) ...
-
bioRxiv - Molecular Biology 2021Quote: ... free fatty acids (myristoleic acid, Sigma-Aldrich, M3525; palmitoleic acid, Sigma-Aldrich, P9417; oleic acid, Sigma-Aldrich, O1008), squalene (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 6-BAP (6-Benzylaminopurine, Sigma-Aldrich) was dissolved in 10mM NaOH and added to PDA media of full ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-hydroxydopamine (6-OHDA; Sigma-Aldrich) was dissolved freshly into sterile 0.9% NaCl and 0.2% ascorbic acid immediately prior to administration to minimize oxidation ...
-
bioRxiv - Biophysics 2024Quote: ... 500 mM 3-(1-Pyridin)-1-Propansulfonat (NDSB-201; Sigma) for protein stabilisation ...
-
bioRxiv - Molecular Biology 2021Quote: ... free fatty acids (myristoleic acid, Sigma-Aldrich, M3525 ...
-
bioRxiv - Biochemistry 2021Quote: Tannic acid and gallic acid (Sigma Aldrich) were dissolved in 150 μM of a combination of citric acid (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... acid phenol:chloroform:isoamyl alcohol (acid PCI; Sigma, P1944), and glass beads ...
-
bioRxiv - Developmental Biology 2019Quote: ... diluted at 1:500 and acetylated-tubulin antibody (Sigma-Aldrich, 6-11B-1) at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Sigma, cat. T6793), 1:50 mouse anti-Synapsin (clone 3C11 ...
-
bioRxiv - Genetics 2022Quote: ... and mouse anti-acetylated tubulin (1:5000, Sigma-Aldrich, clone 6-11B-1). Slides were washed three times in PBS and subsequently incubated for 1 h at room temperature in blocking buffer containing the secondary antibodies conjugated to Ig-Alexa Fluor 568 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-acetylated tubulin clone 6-11B-1 (1:500, Sigma-Aldrich, T6793), mouse anti-gamma tubulin GTU-88 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-acetylated tubulin at 1:1000 (6-11B-1, Sigma-Aldrich). Fluorescent secondary antibodies conjugated to AlexaFluor488 and AlexaFluor564 were used at 1:500 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-acetylated tubulin (Sigma-Aldrich, clone 6-11B-1, 1:1000) rabbit polyclonal anti-POC5 (A303-341A-T ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-acetylated α-tubulin (1:2,000; 6–11B-1; Sigma-Aldrich T6793), rat anti–E-cadherin (1:1,000 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 × 107 PFU per ml of MNV-1.CW3 were incubated at temperatures ranging between 0 and 56°C for 2 or 6 h in the presence or absence of 500 μM bile acid (sodium glycochenodeoxycholate GCDCA, Sigma Aldrich) by enumeration by plaque assay.
-
bioRxiv - Neuroscience 2021Quote: ... age-matched male Tg2576 mice were assigned to receive 6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox, Sigma-Aldrich, St. Louis, MO) by intraperitoneal injection for 1 week ...
-
bioRxiv - Microbiology 2020Quote: ... which was added to the growth media from an Fe(III)-citrate solution prepared by mixing Fe(III)Cl3 (6 mM) and citric acid (12 mM) powders (Sigma-Aldrich) in Milli-Q water ...
-
Development of follicular dendritic cells in lymph nodes depends on retinoic acid mediated signalingbioRxiv - Immunology 2020Quote: ... cells were cultured for 6 hrs either in medium alone or in the presence of retinoic acid (100 nM, Fluka, Sigma-Aldrich, Zwijndrecht ...
-
bioRxiv - Molecular Biology 2024Quote: ... for differentiation induction 100.000 cells were plated in a 6-well plate and maintained in complete media supplemented with 20μM retinoic acid (Sigma-Aldrich, R2625) in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgSO4, 5 mM 6-aminocaproic acid (Sigma, cat. #A2504), 5 mM benzamidine (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: To establish folic acid (FA)-induced nephropathy, mice (25-30g, n= 6-10 mice per group) were injected intraperitoneally with FA (F7876, Sigma-Aldrich, dissolved in 0.3M sodium bicarbonate at a dose of 250 mg/kg) ...
-
bioRxiv - Plant Biology 2023Quote: ... and supernatant was mixed with 6 μL loading buffer (750 mM ε-aminocaproic acid and 5% (w/v) pure Coomassie Brilliant Blue G (B0770, Sigma)) and loaded onto a 6-12% gradient polyacrylamide gel ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-well plates in maintenance media (base culture media further supplemented with 150 µM ascorbic acid (AA, Sigma, cat. no A4544), 3 µM CHIR-99021 (Axon Medchem ...
-
bioRxiv - Microbiology 2024Quote: ... LC-MS grade chemicals Ammonium formate (CAS 540-69-2) and formic acid (CAS 64-18-6) were from Sigma (Germany). Authentic metabolic standards like L-alanine ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal) (Sigma) at a final concentration of 100 μg/ml as indicators ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 6 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s incomplete adjuvant (Sigma-Aldrich) for the first boosting ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5 μM RA treatments on days 0 and 4 plus 10 nM BIO (6-Bromoindirubin-3’-oxime, Sigma) treatment on day 0 ...
-
bioRxiv - Microbiology 2022Quote: ... female 3–4-week-old BALB/c or C57BL/6 mice were injected intraperitoneally with 10mg azoxymethane (Sigma) per kg mouse weight ...
-
bioRxiv - Neuroscience 2023Quote: Five-month-old C57BL/6 mice (13/group; 10 male and 3 female) were administered dexamethasone (D2915, Sigma; 5mg/kg per day ...
-
bioRxiv - Biochemistry 2023Quote: ... The column was eluted using 6 mL of Strep-start buffer supplemented with 3 mM d-Desthiobiotin (Sigma). The elution was diluted with 20 mL of ion-exchange buffer (25 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.