Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-fenylindol (DAPI; 1:10 000; Sigma-Aldrich, Saint-Louis, MO, USA, 28718-90-3) and phosphate buffer (PB ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 µM phytic acid dipotassium salt (Sigma, 5681, CAS: 129832-03-7) for the indicated time.
-
bioRxiv - Plant Biology 2023Quote: ... and supernatant was mixed with 6 μL loading buffer (750 mM ε-aminocaproic acid and 5% (w/v) pure Coomassie Brilliant Blue G (B0770, Sigma)) and loaded onto a 6-12% gradient polyacrylamide gel ...
-
bioRxiv - Neuroscience 2020Quote: ... and the AMPA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 μM, Sigma Aldrich), for 2 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Bacillus cultures were adjusted to 2*10−2 or 8*10−4 at OD600 and 5-fold dilution series were prepared with 6 steps using peptone saline as diluent ([Millipore]; Maximum Recovery Diluent 9.5 g/L). 15 μl of each bacterial dilution was inoculated in consecutive wells by spotting the solution in the center of the wells ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Physiology 2024Quote: ... or acetylated Tubulin (T7451, clone 6-11B-1; Sigma-Aldrich ) at 4° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Then primary mouse monoclonal antibody 6-11B-1 (Millipore Sigma) diluted 1:50 followed by secondary rat-absorbed Alexa 568-conjugated donkey anti-mouse antibody (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... 6% v/v Triton X-100 (EMD Millipore #TX1568-1) added by pipetting for a final concentration of 1% TX-100 ...
-
bioRxiv - Biochemistry 2022Quote: ... using the absorbance measurement of 2,2′-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) substrate at 405 nm (Sigma Aldrich Catalog # 11468120910).
-
bioRxiv - Neuroscience 2021Quote: ... We then prepared a solution of 10 mg/mL 6-hydroxydopamine (6-OHDA; Sigma-Aldrich, H116-5MG) and 0.2% ascorbic acid in saline (0.9% NaCL ...
-
bioRxiv - Neuroscience 2024Quote: ... We additionally prepared a solution of 10 mg/mL 6-hydroxydopamine (6-OHDA; Sigma-Aldrich, H116-5MG) and 0.2% ascorbic acid in saline (0.9% NaCL ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Plant Biology 2024Quote: ... meliloti 1021 (pXLGD4) strain were stained using 5-bromo-6-chloro-3-indolyl-β-d-galactopyranoside (Magenta-Gal, Sigma-Aldrich), according to the protocol described previously by Jarzyniak et al ...
-
bioRxiv - Microbiology 2021Quote: ... using 3-oxo-C12-HSL (Sigma-Aldrich) concentrations from 1 nM to 0.000001 nM in ten-fold increments ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... d-ACC (1-Aminocyclopropane-2,2,3,3-d4-carboxylic acid; Sigma cat#736260), d-IAA([2H5] indole-3-acetic acid ...
-
bioRxiv - Biochemistry 2023Quote: ... N-(3-Oxoocatnoyl)-L-HSL (>97%) (3-Oxo-C8) and N-(3-Oxododecanoyl)-L-HSL (>98%) (3-oxo-C12) were used as received from Sigma-Aldrich. N-(3-Hydroxy-7-cis-tetradecanoyl)-L-HSL (>95% ...
-
bioRxiv - Cell Biology 2020Quote: ... the cells were incubated with 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, cat. D8517, Sigma Aldrich, St. Louis, MO, USA) diluted 1:3000 in PBS 1X and then mounted with Vectashield antifade medium (cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... in PBST and then counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 0.001 mg/mL in 1x PBS, Sigma-Aldrich) for 5 min in the dark ...
-
bioRxiv - Immunology 2019Quote: ... adult animals (6-12 weeks) were perfused with 25 mL of PBS (Hyclone) and 25 mL of 4% paraformaldehyde (PFA, Sigma) sequentially at room temperature (RT) ...
-
bioRxiv - Cell Biology 2021Quote: ... after which we incubated a 20µL pre-isolation aliquot of the filtrate with 0.1µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Millipore-Sigma, cat. #D9542) and mounted on a slide for imaging (Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... after which we incubated a 20µL pre-isolation aliquot of the filtrate with 0.1µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Millipore-Sigma, cat. #D9542) and mounted on a slide for imaging (Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... Free dyes and lipids were then purified away from labeled virus particles by ultracentrifugation for one hour at 4 °C at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...
-
bioRxiv - Microbiology 2020Quote: ... and bacterial nucleoids stained by topping cells with a drop of Fluoroshield™ containing 1.5 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Cover slips were placed over the samples and kept at room temperature for ∼ 30 minutes before cells were imaged.
-
bioRxiv - Physiology 2020Quote: ... Dead cells and debris were excluded by measurements of forward-versus side-scattered light and DAPI (4′,6-diamino-2-phenylindole) (Sigma) staining ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Cell Biology 2021Quote: NCMs were seeded at a density 4 or 8 × 105 cells/well in 6-well plates coated with 0.01% of collagen (Sigma-Aldrich) and cultured in a medium containing DMEM/Medium199 (4:1) ...
-
bioRxiv - Neuroscience 2020Quote: ... After rinsing sections were incubated 10 min at room temperature (RT) with 0.001 % DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, Sigma, D9542) in PBS for nuclear staining ...
-
bioRxiv - Cancer Biology 2019Quote: ... and resuspended in 50 to 80 µl FC buffer containing 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Primary tumor samples were stained with CD45-APC-Cy7 (Biolegend ...
-
bioRxiv - Developmental Biology 2020Quote: ... Next the slides were mounted with a coverslip using Mowiol (6 g glycerol, 2.4 gr polyvinylalcohol 4-88 (Sigma, 81381), 6 ml MQ and 12 ml 0.2 M Tris HCL pH 8.5).
-
bioRxiv - Cancer Biology 2019Quote: ... Tissues were washed 5 times in PBT and incubated for 2h at RT with secondary antibodies and 4’,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma) (1µg/mL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... An incubation was done 45 min at room temperature with a mix of 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, 1µg/mL, 10236276001, Sigma-Aldrich) and the secondary antibody Donkey anti-Mouse Alexa Fluor 555 in PBS 1X ...
-
bioRxiv - Cell Biology 2019Quote: ... then stained in 1x PBS + .5M NaCl with 50 ng/mL 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich #D9542).
-
bioRxiv - Physiology 2021Quote: ... 6 × 105 cells were seeded on 6-well multiwell plates and counted every two days from day 4 to day 14 using Trypan blue (Sigma) and a Neubauer chamber.