Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... and 0.6% sulfosalicylic acid (Sigma-Aldrich; Cat#S2130; CAS: 5965-83-3) in KPE ...
-
bioRxiv - Genomics 2021Quote: Auxin (IAA, 3-Indoleacetic acid) was purchased from Millipore Sigma (45533-250MG) and dissolved in ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: βOHB was (R)-(–)-3-Hydroxybutyric acid sodium salt from Sigma-Aldrich (#298360). Butyrate was Sodium butyrate from Sigma-Aldrich (#303410).
-
bioRxiv - Cell Biology 2020Quote: ... The strips were blocked with 3% fatty acid-free BSA (Sigma-Aldrich) in PBS-T (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... with 3-(trimethylsilyl)-1-propanesulfonic acid sodium salt (DSS, 178837, Sigma Aldrich) as internal standard ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice had unlimited access to water containing 1.5% - 3% citric acid (Sigma) in the standard home cage bottle ...
-
bioRxiv - Neuroscience 2023Quote: ... acid-sensing ion channel 3 (guinea pig anti-ASIC3, Millipore; 1:2000), S100β (rabbit anti- S100β ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mg/mL of poly[(R)-3-hydroxybutyric acid] (Sigma-Aldrich, USA) was used as a PHB standard ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10% polyacrylamide gels supplemented with 0.33 % 3-acrylamidophenylboronic acid (APB; Sigma Aldrich); (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... 3 mg/mL hyaluronic acid sodium salt (HyA, 53747, Sigma-Aldrich, MO), and 0.25% (w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... The mediators used in the potentiometric measurements were methyl viologen (1,1′-Dimethyl-4,4′-bipyridinium dichloride) and pyocyanin (5-Methylphenazin-1-one) also purchased from Sigma-Aldrich. Sodium hydrosulfite and potassium ferricyanide for potentiometric experiments were purchased from VWR.
-
Preferred endocytosis of amyloid precursor protein from cholesterol-enriched lipid raft microdomainsbioRxiv - Neuroscience 2020Quote: ... for 1 h and CHO PS1 ΔE9 cells were treated with 5 mM methyl-β-cyclodextrin (MβCD; Sigma, #332615) for 30 min.
-
bioRxiv - Systems Biology 2023Quote: ... Each cage was provided with a 30 ml glass bottle filled with a solution of 5% glucose and 0.4% methylparaben (methyl 4-hydroxybenzoate, Sigma). A vertically rolled up Whatman filter paper was inserted to soak up the sugar solution and allow mosquitoes to feed on.
-
bioRxiv - Cell Biology 2023Quote: For lipid raft disruption microglial cells were pre-incubated with 5 mM of methyl-β-cyclodextrin (MβCD) (Sigma-Aldrich) for 1 hour.
-
bioRxiv - Bioengineering 2024Quote: ... we used injections of 5 wt% methyl cellulose (MC) (Methocel A15C, [MW = 304 kDa; 27.5–31.5% substitution], Sigma #64625) hydrogels loaded with BDA as a control group in these studies.
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
Systemic administration of Ivabradine, an HCN channel inhibitor, blocks spontaneous absence seizuresbioRxiv - Neuroscience 2021Quote: ... and ELA (N-[4-[2-(3,4-Dihydro-6,7-dimethoxy-2(1H)-isoquinolinyl)ethyl]phenyl]-9,10-dihydro-5-methoxy-9-oxo-4-acridinecarboxamide) were purchased from Sigma-Aldrich. For systemic injections ...
-
bioRxiv - Neuroscience 2023Quote: ... Permeabilisation was achieved by incubation for 1h in freshly prepared blocking solution (PBS with 5% (v/v) normal donkey serum (D9663, Sigma) and 0.3% (v/v ...
-
bioRxiv - Immunology 2024Quote: ... Sections were then blocked for 1h with 300 μl of 5% (v/v) donkey serum (Sigma-Aldrich, St Louis, MO) diluted in TBS-T ...
-
Immune organization in sentinel lymph nodes of melanoma patients is prognostic of distant metastasesbioRxiv - Cancer Biology 2024Quote: ... Sections were then blocked for 1h with 300 µl of 5% (v/v) donkey serum (Sigma-Aldrich, St Louis, MO) diluted in TBS-T ...
-
bioRxiv - Physiology 2020Quote: ... which reacts with indole to produce a colored compound at 565 nm (Sigma, MAK326). Different bacterial strains were cultured overnight at 30°C in TSB media under aerobic conditions (rotating 50-60rpm ...
-
bioRxiv - Physiology 2021Quote: ... Flies were transferred to tubes containing 1 ml Bouin’s fixative (5% acetic acid, 9% formaldehyde, 0.9% picric acid; Sigma) for 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... the γ-secretase inhibitor (2S)-N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine 1,1-dimethylethyl ester (DAPT; R&D) or dimethyl sulfoxide (DMSO; Sigma) was added to media at the concentrations indicated.
-
bioRxiv - Bioengineering 2024Quote: ... 1 μM purmorphamine and 5 μM N-{N-(3,5-difluorophenacetyl-l-alanyl))-(S)-phenylglycine-t-butyl-ester (DAPT; Sigma). At day 6 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Microbiology 2024Quote: ... Measurement of hexosamines (amino sugars) from the deacetylated samples was done by treatment with 3-methyl-2-benzothiazolone hydrazine hydrochloride (MBTH, Sigma-Aldrich) under mildly acidic conditions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and blocked for 1h in 3% BSA (Fisher bioreagents CAS 9048-46-8) and 0.1% Triton X-100 (Sigma 9002-93-1). The cells were then incubated in primary antibody overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Fixation was followed by blocking (1h, RT) with 3% bovine serum albumin (BSA/0.01% Tween™20/PBS) (Sigma, Cat#A-7906). Samples were incubated with primary antibodies (overnight ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... emulsions were partitioned into approximately 2,000 cells per partition before breaking the emulsion by adding one drop (3µL) of 1H,1H,2H,2H-Perfluorooctanol (Sigma-Aldrich) (Zilionis ...
-
bioRxiv - Biochemistry 2020Quote: 500 mg of SBA-15 was mixed with 110 mg of 1H,1H,2H,2H-Perfluorododecyltrichlorosilane (PFDTS) (Sigma Aldrich #729965) or 160 mg of mPEG-Silane (Mn-1,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3D printed models were then plasma-activated and silanized with vapored trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma-Aldrich) overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... flow channels of the Drop-seq chip were subjected to a hydrophobicity treatment using 1H,1H,2H,2H-Perfluorodecyltrichlorosilane (in 2% v/v in FC-40 oil; Alfa Aeser/Sigma). After 5 min of treatment ...
-
bioRxiv - Molecular Biology 2020Quote: ... the excess of Picosurf-1 was removed from the nanoreactor bead emulsion and 1H,1H,2H,2H-perfluorooctanol (PFO; Sigma) was added to the same volume ...
-
bioRxiv - Genomics 2023Quote: ... following silanisation of the backend of the nanopipette by exposure to Trichloro(1H, 1H, 2H, 2H-perfluorooctyl)silane (Sigma Aldrich) for 10 seconds until the glass wall appeared mat ...
-
bioRxiv - Molecular Biology 2024Quote: ... The droplet emulsion was then incubated for 10 mins before being disrupted with 1H,1H,2H,2H-perfluoro-1-octanol (Sigma) and beads were released into aqueous solution ...
-
bioRxiv - Bioengineering 2023Quote: ... 200 µL of a solution containing 50 % (v/v) of 1H,1H,2H,2H-perfluoro-1-octanol (PFO) (Sigma-Aldrich) dissolved in NovecTM-7500 Engineered Fluid (3M ...
-
bioRxiv - Bioengineering 2023Quote: ... 200 µL of a solution containing 50 % (v/v) of 1H,1H,2H,2H-perfluoro-1-octanol (PFO) (Sigma-Aldrich) dissolved in NovecTM-7500 Engineered Fluid (3M ...
-
bioRxiv - Bioengineering 2022Quote: ... The master mold was then silanized in a vacuum desiccator with Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma-Aldrich,) for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... The droplet emulsion was then incubated for 10 mins before being disrupted with 1H,1H,2H,2H-perfluoro-1-octanol (Sigma) and beads were released into aqueous solution ...
-
bioRxiv - Systems Biology 2023Quote: ... Then the two masters were exposed to trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma-Aldrich Chemie N.V., Zwijndrecht, Netherlands) for 2 h ...