Labshake search
Citations for Millipore Sigma :
951 - 1000 of 10000+ citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Cell Biology 2024Quote: ... or pre-treated for 5 min and then incubated with 5 mM succinate (Sigma), or both in combination ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma cat# N2630) was added to each well immediately before measurements ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...
-
bioRxiv - Biochemistry 2023Quote: ... Disodium salts of nucleoside-5’-monophosphates (5’-NMPdss) were purchased from Sigma-Aldrich (Bangalore). All other reagents were purchased from Sigma-Aldrich and were of alalytical grade.
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Microbiology 2023Quote: ... low = 5 X 105 parasites) or concanamycin A (CON A) (5 μg/ml, Sigma); supernatants were harvested at 72 h ...
-
bioRxiv - Immunology 2023Quote: ... 5 ml of PBS and 5 ml of 4% Dextran (Sigma-Aldrich, 31392-50G) in PBS (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma, D2926, resuspended to 5 mM in DMSO) in Hanks Balanced Salt Solution (HBSS ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 5 min and blocked in 5% FBS (Sigma Aldrich, cat. no. F7524-500ml), 0.1% Triton™ X-100 ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... the cells were exposed to 1 mM 5-fluorouracil (5-FU; Sigma, Cat# F5130) for 15 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Following concentration ranges were tested: 100–0.1 µM for 5-fluorouracil (5-FU, Sigma), alpelisib (Biozol ...
-
bioRxiv - Microbiology 2019Quote: ... 135 µL of culture was distributed in a 96-well plate (Cellstar, 96 Well Cell Culture Plate, U-bottom) and 15µL of H2O or Mitomycin C (Sigma)) was added at the appropriate dilution ...
-
bioRxiv - Synthetic Biology 2021Quote: ... media in each well was replaced with 100µL (for 96-well plate format) or 200µL (for 48-well plate format) complete DMEM in addition to 2µM ionomycin (Sigma-Aldrich) and 5mM CaCl2 with or without 10µM furimazine (unless indicated otherwise) ...
-
bioRxiv - Neuroscience 2022Quote: ... and seeded at a density of 2 × 106 cells per well (6-well plates) or 0.5 × 106 cells per well (24-well plates) into PDL/Laminin (Sigma)-coated plates with neuronal medium plus 0.5 μM RA ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected CAD5 cells were seeded in ELISPOT plates (multiscreen 96-well filter plates with high protein-binding Immobilon-P membrane, 0.45 µm, Millipore) activated with 70% ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Dilutions were plated on TY plate and in TY plate containing either 750 µM of DEA NONOate (Sigma-Aldrich), 0.1% of NaClO (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... regular NGM plates served as a control and treatment plates were supplemented with 400μM Coenzyme A (Sigma-Aldrich, C4780).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/mL Insulin (Sigma), 10 ng/mL EGF (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... 5% (Sigma, catalog # S-5761).
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM ATP (A2383, Sigma), 1 mM tris(2-carboxyethyl)phosphine (TCEP ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% Kolliphor HS-15 (Sigma) and 90% saline and delivered by intraperitoneal injection daily ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM pyruvate (Sigma-Aldrich) and 0.56 μL ml-1 NaOH (1M) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM Trolox (Sigma-Aldrich), and 10 mM sodium azide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 5% horse serum (Sigma), EGF (20ng/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% formamide (Sigma-Aldrich #F9037), 0.5x SSC (75 mM NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml insulin (Sigma), 50 μg/ml gentamicin (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% BSA (A4503, Sigma) for one hour at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 ng/mL EGF (Sigma), 3 ng/mL mFGF2 (R&D Systems) ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/ml insulin (Sigma) and 0.05 mM β-mercaptoethanol (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/mL kanamycin (Sigma) and 250 ng/mL amphotericin B (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1mM 5-Ethynyluridine (Sigma Aldrich) was added to the culture medium and the plate was incubated for 2 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μM sunitinib malate (Sigma), or 5 μM ISCK03 (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... or 5 μM ISCK03 (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μM imatinib mesylate (Sigma), 5 μM sunitinib malate (Sigma) ...
-
Differential polysaccharide utilization is the basis for a nanohaloarchaeon : haloarchaeon symbiosisbioRxiv - Microbiology 2019Quote: ... 5 mM TCEP (Sigma-Aldrich) and a protease inhibitor cocktail (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μg/ml puromycin (Sigma,) was added in the culture medium and incubated for 1 h at 37 °C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RB1 (Ab-5, OP66; Millipore), and Rb1 (SC-74570 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 % donkey serum (Sigma). The following day ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5) Sodium Selenite (Sigma S5261) - add 5 µL of 3 mM stock solution per 500ml HENSM media ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 mM glucose (Sigma G8270), appropriate osteogenic inducer ...
-
bioRxiv - Immunology 2021Quote: ... ATP (5 mM, Sigma-Aldrich) and Alum (300 μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% human serum (Sigma-Aldrich), 1x MEM Vitamins (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% human serum (Sigma-Aldrich) and 100 μg/ml primocin (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% human serum AB (Sigma), penicillin-streptomycin (Gibco) ...