Labshake search
Citations for Millipore Sigma :
951 - 1000 of 10000+ citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 96-well EIA/RIA plates (Sigma Aldrich) were coated overnight with 0.5ug/ml NP23-BSA in PBS at room temperature and thereafter washed once in wash buffer (PBS+ 0.1% Tween20 ...
-
bioRxiv - Microbiology 2021Quote: Millipore ELISPOT plates (Millipore Ltd, Darmstadt, Germany) were coated with anti-IFN-γ capture Ab (CTL ...
-
bioRxiv - Neuroscience 2019Quote: ... black wall plates (Sigma cat# CLS3340-50EA), transduced on 1-3 day in vitro (DIV) ...
-
bioRxiv - Microbiology 2020Quote: MultiScreen-HA filter 96-well plates (Millipore) plates were pre-coated with 3 µg/ml of SARS-CoV-2 S protein overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... plates were supplemented with 1% DMSO (Sigma) as control ...
-
bioRxiv - Cancer Biology 2021Quote: ... conical 96 well non-skirted plates (Sigma) containing 2μl of lysis buffer (1.9ml of 0.2% v/v Triton-X l00 v/v + 0.1ml of RNasin Plus RNase inhibitor (10,000 U/ml ...
-
bioRxiv - Immunology 2020Quote: ... ELISpot plates (Multi Screen-HA, Millipore, UK) were coated with 100 μl per well of appropriate antigen or antibody diluted in carbonate/bicarbonate buffer for 2h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... 96-well ELISpot plates (Millipore, Cat# MSIP45) were coated overnight with either Dengue 2 fixed virus antigen (Microbix ...
-
bioRxiv - Immunology 2020Quote: ... Plates were developed with TMB substrate (Sigma), stopped with 0.15M sulphuric acid and read at 450nm ...
-
bioRxiv - Immunology 2021Quote: ... ELISPOT plates (S5EJ044I10; Merck Millipore, Darmstadt, Germany) pre-wetted with 30 µl of 70% ethanol for a maximum of 2 minutes ...
-
bioRxiv - Immunology 2020Quote: ... ELISpot plates (Multi Screen-HA, Millipore, UK) were coated with 100 µl per well of appropriate antigen or antibody diluted in carbonate/bicarbonate buffer for 2h at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... The plate was then sealed (Sigma, Z369667) and incubated at 60°C for 20 mins ...
-
bioRxiv - Microbiology 2022Quote: ... using plates coated with GM1 (Sigma G7641), as previously described91.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plates were sealed with Aeraseal (Millipore-Sigma) and put in a 37C incubator maintained at 5% CO2 for 30 minutes to equilibrate ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plates were sealed with Aeraseal (Millipore-Sigma) and put in a 37C incubator maintained at 5% CO2 for 30 minutes to equilibrate ...
-
bioRxiv - Biochemistry 2022Quote: ... lidded Greiner 96-well plates (Sigma-Aldrich). To assess the impact of peptides ...
-
bioRxiv - Microbiology 2023Quote: ... and plates developed using TMB substrate (Sigma), stopped using sulphuric acid and read at 450nm ...
-
bioRxiv - Microbiology 2022Quote: ... and LB agar plates (1.5% agar, Sigma) supplemented with antibiotics as indicated ...
-
bioRxiv - Immunology 2022Quote: ... 96-well MultiScreenHTS IP Filter Plate (Millipore) was activated with 35% ethanol and coated with 15 µg/ml MT327 coating antibody overnight at 4C ...
-
bioRxiv - Microbiology 2023Quote: ... Millipore ELISPOT plates (Millipore Ltd, Darmstadt, Germany) were coated with 100 µl rSARS-CoV-2 spike protein (R&D Systems) ...
-
bioRxiv - Immunology 2023Quote: ... Transwell plates were from Sigma-Aldrich (#CLS3470).
-
bioRxiv - Immunology 2023Quote: ... MultiScreen-IP Filter plates (MAIPSWU10; Merck Millipore) were pre-wetted with 50 µL of 70% ethanol for ≤ 2 mins ...
-
bioRxiv - Cancer Biology 2023Quote: White-bottom ELISpot HTS plates (MSIPS4W10, Millipore) were hydrophilized with 35 % EtOH and subsequently coated with anti-human IFNγ (1-D1K ...
-
bioRxiv - Neuroscience 2023Quote: ... plates sealed with BreathEasy membrane (Sigma Aldrich), and placed in 5% CO2 incubator at 37°C for duration of experiment ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with avidin-HRP (Sigma) (1:500 in blocking buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... NUNCImmuno 96-well plates (SIGMA-M9410-1CS) were coated with 100 µL of 4 µg/mL polyclonal anti-lysostaphin antibody (AICBIOTECH-PAb102 ...
-
bioRxiv - Biochemistry 2023Quote: ... For plates receiving asparagine (Sigma-Aldrich, A7094), this was added to 1 mM from a 20x solution in water ...
-
bioRxiv - Immunology 2024Quote: ... The 96-well ELISPot filter plates (Millipore) were pre-coated with 15 μg/ml capturing monoclonal anti-human IgG mAbs (Mabtech ...
-
bioRxiv - Immunology 2019Quote: ... scFv secretion levels were analyzed by ELISA after coating with HEL antigen (Sigma-Aldrich, 62971, 4 μg ml-1) in PBS (Thermo ...
-
bioRxiv - Immunology 2019Quote: ... IL-17 and CCL17 were determined with ELISA assays according to the manufacturer’s protocols (Sigma, St. Louis, MO, USA).
-
bioRxiv - Physiology 2021Quote: ... and adipokine levels were measured via ELISA (adiponectin: Millipore EZ-MADPK, leptin: Millipore EZML-82K, resistin: R&D MRSN00). For HFD experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... The effect of DMAPT on cell proliferation was measured using the Bromodeoxyuridine (BrDU) incorporation-ELISA (Millipore, Cat. No. 2752) as per the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... or IgG2a-HRP conjugated (Southern Biotechnology Associates) and TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...