Labshake search
Citations for Millipore Sigma :
51 - 100 of 2489 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... pLKO.1-Neo-CMV-tGFP TIAM1 shRNA plasmid (Sigma Aldrich, Cat # 07202334MN ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the MISSION shRNA lentiviral plasmids pLKO.1-puro with shRNA target sequence CCAGATGACTTGATCGGATAT (TRCN0000190340, Millipore Sigma) and pLKO.005-puro with shRNA target sequence GTTGGCCTGAACCTGCTTTAT (TRCN0000382281 ...
-
bioRxiv - Neuroscience 2023Quote: ... received a non-target shRNA viral injection (NT-shRNA; SHC016: MISSION® pLKO.1-puro non-Target shRNA Control Plasmid DNA; Sigma Aldrich, St. Louis, MA, USA) to determine any effects of surgery alone on respiratory behaviour ...
-
bioRxiv - Biochemistry 2021Quote: ... 105 MA104 cells were co-transfected with the plasmid pCMV-HyPBase encoding the hyperactive variant of PiggyBac transposase56,57,22 along with the plasmid pPB[shRNA]-EGFP:T2A:Puro-U6 harbouring shRNA targeting RVA NSP2 gene using Lipofectamine 3000 (Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... SK.N.BE2 cells were infected with TRIM67 Mission lentiviral shRNA plasmids (Sigma). For virus production ...
-
bioRxiv - Neuroscience 2020Quote: ... We also used MISSION shRNA plasmids for mouse Paics (Sigma-Aldrich). Among five clones (TRCN0000076100 ...
-
bioRxiv - Microbiology 2023Quote: ... pPAX2 and pLKO.1-puro shRNAs expressing plasmids (MISSION, Sigma-Aldrich). Produced lentiviruses were concentrated and quantified as previously ...
-
bioRxiv - Physiology 2024Quote: ... Plasmids containing these shRNAs were obtained from Sigma (St. Louis, MO). We determined that the targeting sequence CCGTCCCTACATGGATGAAAT was most efficient in knocking down mTOR in primary human trophoblast cells ...
-
bioRxiv - Cancer Biology 2019Quote: Control pLKO.1-LacZ shRNA and four different lentiviral shRNA pLKO.1 plasmids designed to silence DARPP-32 protein expression were purchased from Sigma. To prepare the lentivirus ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (CAACAAGATGAAGAGCACCAA) or ATF4-targeted shRNA (GCCTAGGTCTCTTAGATGATT) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.6 µg of DNA per well with the GFP-LC3B expression plasmids with or without scrambled shRNA or a mixture of five FYCO1-targeting shRNAs (Sigma Aldrich). The efficiency of shRNAs targeting Fyco1 in mouse cells were verified in N2A neuroblastoma cells (Figure S4D) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Non-targeting control pLKO shRNA lentivirus plasmid (MISSION, SHC002) was kindly provided by Tianyan Gao and pLKO shRNAs targeting PTP4A3 were purchased from Sigma-Aldrich; target sequences are listed in Supplemental Table 2.
-
bioRxiv - Neuroscience 2020Quote: ... a modified pLKO.5 vector containing shRNA expression cassettes targeting syt1 (TRCN0000093258) and syt9 (TRCN0000379591) from Mission shRNA plasmids (Sigma-Aldrich) was used.
-
bioRxiv - Cancer Biology 2023Quote: ... Stable KD of EIF4G2 was generated by infecting HEC-1A or RL95-2 cells with lentiviruses harboring pLKO.1-puro plasmid expressing shRNA targeting GFP (Control) or shRNA targeting EIF4G2 (Sigma TRCN0000147914), followed by selection using puromycin ...
-
bioRxiv - Cell Biology 2024Quote: ... individual ACVRL1-targeting short hairpin-RNA (shRNA) clones (Table 1) were inserted into the MISSION® 3X-LacO Inducible shRNA plasmid backbone (Sigma). Both clones target a similar region in the ACVRL1 transcript and produced similar levels of knockdown ...
-
bioRxiv - Cancer Biology 2020Quote: ... cloned into the pLKO.1 puro-vector (MISSION® shRNA plasmids, Sigma), were used ...
-
bioRxiv - Cancer Biology 2022Quote: As lentiviral shuttle backbone we used a pLKO shRNA plasmid (Mission SIGMA). As control we used pLKO shRNA empty expression vectors ...
-
bioRxiv - Immunology 2022Quote: ... pLKO.1 plasmids either containing the shRNA sequence: CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTT-CTGCTTTTTTG (TRCN0000148136, SIGMA) or the scrambled shRNA sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid encoding the shRNA against CDT1 was from Sigma-Aldrich (TRCN0000174484). The CDT1-pCDNA3 plasmid is described in Coulombe et al.42.
-
bioRxiv - Immunology 2020Quote: Plasmid included Mission® pLKO-puro Non-Target shRNA (Sigma-Aldrich, #SHC016V), pLKO shRNA targeting BBS1 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and the non-target control shRNA plasmid were purchased from Sigma-Aldrich. Lentivirus-containing supernatants were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... shRNA plasmids were cloned by the insertion of the siRNA sequences (Sigma) shown to be effective against Ncan mRNA (Okuda et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... shRNA plasmids were cloned by the insertion of the siRNA sequences (Sigma) shown to be effective against Ncan mRNA (Okuda et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... VAMP7 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000059892), Rab6 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... GMAP210 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000022021), VAMP7 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Rab6 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000379588), and Synt16 shRNA (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... or SERPINB3 shRNA (Sigma Mission shRNA, TRCN0000052400). Genetically modified cells were generated through a lentivirus system by transfection of human 293T packaging cells ...
-
bioRxiv - Immunology 2019Quote: ... Mul1 shRNA lentiviruses (shMul1) were prepared using commercial plasmids (TRCN0000040742 and TRCN0000328514, Sigma); TRCN0000040742 ...
-
bioRxiv - Cell Biology 2021Quote: MLK3-shRNAs in lentiviral vector pLKO.1-Puro plasmids were obtained from Sigma. Other plasmids used for lentivirus production were purchased from Addgene ...
-
bioRxiv - Neuroscience 2020Quote: Pre-validated shRNA plasmids were identified on the Broad Institute RNAi Consortium shRNA Library Database and purchased from Sigma-Aldrich (St. Louis, MO). Multiple shRNA plasmids were tested by immunostain analysis of Nav1.1 density (see Supplemental Figure 5 for validation data) ...
-
bioRxiv - Cell Biology 2023Quote: ... from the pLKO1.puro plasmid were generated with the targeting sequence of the ITCH gene AACACCTCGAGACAACCTC (shEE162) and the shRNA control CAACAAGATGAAGAGCACCAA (Sigma MISSION Target shRNA). Selection was carried out using 1µg/ml of puromycin for 48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and Synt16 shRNA (Sigma-Aldrich, Mission shRNA, TRCN0000161930). Lentivirus were recovered in supernatant after 2 days and concentrated ...
-
bioRxiv - Neuroscience 2023Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Neuroscience 2024Quote: ... The shRNA universal negative control (Sigma, Control shRNA) was used as a non-targeting control (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... shRNA clones were purchased from lentiviral vector-based shRNA libraries (MISSION shRNA library, Sigma-Aldrich). Lentivirus packaging was performed as previous reported (89) ...
-
bioRxiv - Cell Biology 2021Quote: ... For Syntenin-1 target pLKO.1 plasmids with shRNA sequences were obtained from Sigma mission library (KD1 ...
-
bioRxiv - Cell Biology 2022Quote: ... a plasmid (pLKO.1-puro backbone) containing shRNA sequence (CCGGGATGAAGAATATCGTCCACAACTCGAGTTGTGGACGATATTCTTCATCTTTTTG) was purchased from Sigma (Mission shRNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The non-silencing shCTR (mission control shRNA plasmid DNA) was purchased from Sigma aldrich. Transfection medium was replaced 24 h later with new complete DMEM and 48 h after transfection the lentiviral containing medium was collected ...
-
bioRxiv - Cancer Biology 2023Quote: ... the DNA mix (1.34 μg shRNA-plasmid DNA (TRCN0000296954; TRCN0000291711, Sigma-Aldrich, Taufkirchen, Germany) or pLV[Exp]-EGFP:T2A:Bsd-CMV>ORF_Stuffer (VectorBuilder ...
-
bioRxiv - Genomics 2022Quote: Non-targeting shRNA construct was obtained from Sigma (SHC202; pLKO.5-puro Control Plasmid). Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID ...
-
bioRxiv - Cell Biology 2023Quote: ... shRNA plasmid against mouse HK1 and empty vector control were purchased from Sigma-Aldrich MISSION.
-
bioRxiv - Cell Biology 2023Quote: ... RBL2 and non-targeting control shRNA lentiviral transfer plasmids were either purchased from Sigma or generated by cloning sequences into pSicoR-Ef1a-mCh-Puro-Puro (#31847;Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: Pre-designed shRNA sequences (MISSION® shRNA library (Sigma); Table 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... 10µg of shRNA vector (Mission® shRNA, Sigma Aldrich), 2.9µg pRSV-REV ...
-
bioRxiv - Cancer Biology 2021Quote: ... were subjected to lentiviral transduction with either the Tg2-targeting MISSION shRNA plasmid (SHCLND-NM_004613: TRCN0000272816) (MDA- (scr)) or the MISSION scr.1-puro scrambled control plasmid DNA (SHC001; Millipore Sigma) (MDA- (shTg2)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... As a negative control a plasmid expressing the scramble sequence (MISSION pLKO.1-puro shRNA Control Plasmid DNA) was purchased from Sigma- Aldrich.
-
bioRxiv - Cell Biology 2022Quote: ... the same pLKO-based plasmid expressing a non-target shRNA was purchased from Sigma-Aldrich and used ...
-
bioRxiv - Cell Biology 2019Quote: shRNA expression plasmids (in pLKO.1 or pLKO1.5) were obtained from Sigma (Supplemental Table 4). pLKO.3G (Addgene ...
-
bioRxiv - Physiology 2019Quote: ... Plasmids encoding shRNA for mouse LPCAT3 (shLPCAT3: TRCN0000121437) were obtained from Sigma (St. Louis, MO). Packaging vector psPAX2 (ID #12260) ...