Labshake search
Citations for Millipore Sigma :
51 - 100 of 5402 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The SYBR Green quantitative PCR kit (Sigma) was used with the following primers ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified using GenElute™ PCR Clean-Up Kit (Sigma-Aldrich), after restriction digestion of the PCR mixture with DpnI (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... PCR purification was performed using the GenElute PCR Clean-Up Kit (Sigma-Aldrich). Gibson assembly was done using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... PCR purification was conducted using GenElute™ PCR Clean-Up Kit (Sigma Aldrich) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... To transduce cells with virus cells were treated with both virus (MOI 0.5-1.0) and 5 μg / mL Polybrene infection reaction (EMD Millipore, TR-1003). For pLKO.1 vectors ...
-
bioRxiv - Neuroscience 2023Quote: Microglia phagocytosis performance was measured by using fluorescent yellow-green latex beads (Sigma-Aldrich; L4655-1ML). 100-500 thousand MGL cells/well were plated in 24 well plates ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% fly serum and insulin (5 mg/ml) by pipetting using coated yellow tips (Sigmacote, Sigma).
-
bioRxiv - Molecular Biology 2022Quote: ... For each 10 cm dish, 1 ml virus inoculum was prepared in virus growth media (VGM; containing DMEM, 0.2% bovine serum albumin (Sigma; Cat no. #A8412), 25 mM N-(2-hydroxyethyl ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were purified with GenElute PCR Clean-Up Kit (Sigma-Aldrich NA1020). The expression vector pET302/NT-His was digested with EcoR1 restriction enzyme (NEB R0101S ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then purified using the GenElute PCR Clean-Up Kit (Sigma-Aldrich). Samples were stored overnight at −20°C prior to library construction.
-
bioRxiv - Genomics 2021Quote: PCR barcoding was performed using Kapa 2G Robust PCR kit (Sigma Catalogue No. KK5005) as follows ...
-
bioRxiv - Genetics 2022Quote: ... all PCR products were amplified using Roche Expand High Fidelity PCR kit (Sigma 11732641001), which contains a 3’-adenine overhang-depositing Taq ...
-
bioRxiv - Molecular Biology 2024Quote: ... the nested PCR were conducted using Phusion RT-PCR Enzyme Mix kit (Sigma-Aldrich), primers Bat1F 5’-GGTTGGGACTATCCTAAGTGTGA-3’ and Bat1R 5’-CCATCATCAGATAGAATCATCAT-3’ and 1 uL of the amplified product as a template were used ...
-
bioRxiv - Microbiology 2020Quote: ... Aggregated virus was removed by a 0.22µm filter (Millipore). Sub-confluent monolayer of MEFs cultured in DMEM ...
-
bioRxiv - Physiology 2020Quote: ... Virus was filtered with a 0.45mm OVDF filter (Millipore). Supernatants were collected and purified using PEG-it (System Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... supernatant containing virus was filtered with 0.22μm filters (Millipore) and store at −80◻ in aliquots.
-
bioRxiv - Cancer Biology 2023Quote: ... adherent cells were infected with COL7A1 virus (Sigma Aldrich) (1–5 MOI (multiplicity of infection) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the virus was concentrated using polyethylglycol (Sigma, P4338). Cells were infected in medium containing 5 μg ml−1 polybrene (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... After purification with PCR Cleanup kit (Sigma-Aldrich), nucleic acids were eluted in 100 μL of elution buffer (5 mM Tris-HCl pH 8.5 ...
-
bioRxiv - Microbiology 2022Quote: The KAPA Taq PCR Kit (Sigma-Aldrich KR0352_S) was used to amplify the reads from a cDNA mixture of uninfected samples and 1 ...
-
bioRxiv - Microbiology 2024Quote: ... purified (GenElute PCR Clean-up kit, Sigma Aldrich) and quantified using a Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... The LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich) was used to assure that all cell lines were mycoplasma-free ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was converted to cDNA using the First Strand cDNA synthesis kit for reverse transcription (avian myeloblastosis virus [AMV]; Millipore-Sigma). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... All cells were regularly tested for the presence of mycoplasma using the PCR Mycoplasm Test Kit (PromoKine) or the LookOut Mycoplasma PCR detection kit (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2020Quote: The fluorescent markers used were Lucifer yellow CH (dilithium salt, L0259-25MG, Lot# MKBS3318V, Sigma-Aldrich, Germany), F4FF (Fluo-4FF penta-K+ salt ...
-
bioRxiv - Developmental Biology 2022Quote: ... Several probes were produced by PCR amplification (KAPA2G Fast ReadyMix PCR kit, Sigma Israel, KK5101). cDNA templates were synthesized by RNA precipitation followed by reverse transcription PCR ...
-
Multi cell line analysis of lysosomal proteomes reveals unique features and novel lysosomal proteinsbioRxiv - Molecular Biology 2020Quote: ... PCR products were purified with the High Pure PCR Product Purification Kit (Sigma Aldrich, 11732676001) and cloned into the pcDNA3.1 Hygro+ mammalian expression vector (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... For gene expression analysis one-step qRT-PCR (SYBR Green Quantitative RT-PCR kit, Sigma) was carried out ...
-
bioRxiv - Genomics 2024Quote: ... a second PCR was performed using the Phusion RT-PCR Enzyme Mix kit (Sigma-Aldrich) and primers Bat1F 5’- GGTTGGGACTATCCTAAGTGTGA -3’ and Bat1R 5’-CCATCATCAGATAGAATCATCAT-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was converted to cDNA using the First Strand cDNA synthesis kit for reverse transcription (avian myeloblastosis virus [AMV]; Millipore-Sigma). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2023Quote: ... the gradient-purified virus was subjected to buffer exchange using the Pur-A-Lyzer™ Maxi Dialysis Kit (20k MWCO) (Sigma) at 4°C overnight to replace the iodixanol with PBS.
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were stored in aliquots containing 10% sucrose (Sigma) at −150°C ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... Input virus was treated with benzonase (500U/mL, Sigma-Aldrich) before cell exposure to reduce nucleic acid contamination in the viral stock ...
-
bioRxiv - Neuroscience 2021Quote: ... Concentration of virus was repeated on smaller Amicon Ultracels (Millipore) until desired high titer was reached ...
-
bioRxiv - Cell Biology 2021Quote: ... with 60 μg of Tobacco etch virus protease (Sigma-Aldrich) added in the dialysis cassette to cleave the histidine tag ...
-
bioRxiv - Microbiology 2020Quote: ... virus was preincubated with the compound (human (Sigma-Aldrich #L8402) or chicken (Sigma-Aldrich #L4919 ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μl of virus suspension and Polybrene (hexadimethrine bromide, Sigma) at a final concentration of 8 μg/ml were added ...
-
bioRxiv - Microbiology 2023Quote: Swabs were stored in virus cultivation medium (Sigma-Virocult®). Archived swabs and organ samples were kept at-70 °C until final analyses ...
-
bioRxiv - Microbiology 2023Quote: ... virus was filtered using a millipore filter (Millipore Sigma, SE1M179M6). On day of infection ...
-
bioRxiv - Microbiology 2023Quote: ... virus was treated with alpha-1-antitrypsin (Sigma-Aldrich, SRP6312) at the concentration noted ...
-
bioRxiv - Plant Biology 2023Quote: ... and then the tobacco etch virus (TEV) protease (Sigma-Aldrich) was added to remove the purification tags ...
-
bioRxiv - Microbiology 2023Quote: ... Virus propagation was performed in VeroE6 cells in DMEM (Sigma) supplemented with 2% fetal calf serum (Logan) ...
-
bioRxiv - Cancer Biology 2020Quote: ... or the LookOut Mycoplasma PCR detection kit (Sigma-Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... Amplicons were purified using a PCR cleanup kit (Sigma) and quantified using a Qubit 2.0 fluorometer (Invitrogen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... using RedExtract-n-Amp tissue PCR kit (Sigma-Aldrich). The G2 progeny of genome-edited males were then raised until homozygous stocks were established ...
-
bioRxiv - Neuroscience 2022Quote: Mitochondrial or cellular hydrogen peroxide (H2O2) levels were measured in fibroblasts using mitochondria peroxy yellow 1 (MitoPY1) (Sigma) or Amplex Red reagent and horseradish peroxidase from the Amplex® Red Catalase Assay Kit (Molecular Probes) ...
-
bioRxiv - Bioengineering 2024Quote: ... have been colored with either Solvent Yellow 7 or with Solvent Green 3 (Sigma-Aldrich, St. Louis, MO) at concentrations of 0.50 mg/mL and 1.43 mg/mL respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... Polymerase chain reaction (PCR) samples were prepared using KAPA2G Fast PCR Kit (Sigma St. Louis, MO) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR-based method was used for detection of Mycoplasma with LookOut Mycoplasma PCR Detection Kit (Sigma) and JumpStart Taq DNA Polymerase (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was purified using the GenElute PCR purification kit (Sigma-Aldrich, St. Louis, MO). The indexing PCR was carried out to attach the dual indices (Appendix D6.2 ...