Labshake search
Citations for Millipore Sigma :
51 - 100 of 6671 citations for ATF4 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5 IgM, 1:1000, Abcam, and rat anti-HA MAb 3F10, 1:50, Roche, or rabbit anti-FLAG, 1:1000, SIGMA) followed by incubation with Alexa488- and/or Alexa647-coupled secondary antibodies (Molecular Probes ...
-
bioRxiv - Microbiology 2022Quote: ... and incubated overnight at 4°C with specific primary monoclonal (MAbs) or polyclonal (pAbs) antibodies: anti-HA tag (rabbit pAb; H6908, Sigma), anti-GFP (rabbit pAb ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (CAACAAGATGAAGAGCACCAA) or ATF4-targeted shRNA (GCCTAGGTCTCTTAGATGATT) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... γH2AX (mouse mAb, clone JBW301, Millipore Sigma) histone H3K27me3 (rabbit ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-tubulin (1A2) mouse mAb (Sigma, T9028), anti-NTF2 (5A3 ...
-
bioRxiv - Neuroscience 2022Quote: ... and HuNu (Millipore MAB 1281, 1:300). Secondary antibodies were Alexa 488 donkey anti-rabbit (A21206 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5µL of SC35 mAb (Sigma-Aldrich, S4045) and 25µL of control IgG1 (Santa Cruz ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-MAP2 mAb (Sigma, M4403, 1:500); anti-nicastrin pAb (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... FLAG M2 Mouse mAb (#F1804-200UG; Sigma), p62 Mouse Ab (#H00008878-M01 ...
-
bioRxiv - Cell Biology 2022Quote: ... α-Tubulin Mouse mAb (#T6074-100UL; Sigma), α-Tubulin Rabbit Ab (#2144S ...
-
bioRxiv - Immunology 2022Quote: ... and anti-α-tubulin mAb (T5168, Sigma).
-
bioRxiv - Cancer Biology 2022Quote: ... Flag mAb (1:1000; Sigma, no. F3165), FASN Rabbit mAb (1:1000 for western blot ...
-
bioRxiv - Microbiology 2021Quote: ... mAb 93k or mouse anti-gE (Millipore). The anti-gE mAb is very sensitive and can detect low concentrations of gE [36,80–82] ...
-
bioRxiv - Immunology 2020Quote: ... mAbs were digested by papain (Sigma-Aldrich) at 37°C for 24 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... PPP2R5D (Mouse mAb; Millipore, [H5D12] 04-639), PPP2R5E (Mouse mAb ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse mAb anti-c-myc (9E10, Sigma), rabbit anti-FLAG (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse mAb to vinculin (1:1000; Millipore), rabbit pAb to integrin-α11 (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and anti-tubulin (mouse mAb, T9026, Sigma). Secondary-HRP antibodies ...
-
bioRxiv - Immunology 2021Quote: ... DEFA5 (mouse mAb, clone 8C8, Millipore Sigma), and SC-166 (mouse mAb provided by Dr ...
-
bioRxiv - Cancer Biology 2021Quote: anti-IDO1 MAb (Clone 10.1, Chemicon-Millipore), anti-Foxp3 MAb (Clone ab22510 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-α-tubulin mAb (1:3000, Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... Cyclin B1 (mouse mAb; Millipore, 05-373), pT320 PPP1CA (rabbit mAb ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:500 GFAP-488 (Millipore MAB 3402X), and 1:500 rabbit anti-IBA1 (wako 019-19741) ...
-
bioRxiv - Genomics 2023Quote: ... the rat anti-HA mAb 3F10 (Sigma) was used at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... mAb β-Actin (Sigma-Aldrich, Darmstadt, Germany) was used in Western blot analyses to detect cellular β-actin as loading control.
-
bioRxiv - Cell Biology 2023Quote: ... gamma-Tubulin Ms mAb T5326 (Sigma Aldrich) 1:2500 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal antibody against Tamr1 (mAb 1D11), anti-Ta-p104 (Clone IC12, polyclonal mouse antiserum) and rabbit monoclonal anti-acetyl H4 (Sigma-Aldrich). Antibodies were diluted in PBS-1% BSA-0.3% Triton X100 (PBST) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were incubated with primary antibodies overnight at 4°C (rabbit anti-ORF2 mAbs at 1:1000; mouse anti-Flag M2 (Sigma F1804) at 1:2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... The following commercial primary antibodies were used: rabbit anti-Olig2 antibody and mouse anti-panNav mAb (clone K58/35) purchased from Sigma-Aldrich Chimie ...
-
bioRxiv - Neuroscience 2021Quote: ... recombinant human apoE4 (Sigma), and ThT (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant hyaluronidase (Sigma, H3506) was treated at 10 μg/mL ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant neuraminidase (Sigma, N2876) was treated at 1 U/mL ...
-
bioRxiv - Immunology 2022Quote: ... recombinant CD4 (Sigma Aldrich) were added to 20 μl of KSRB with 1mM APMA ...
-
bioRxiv - Bioengineering 2023Quote: ... human recombinant LIF (Millipore), and Heparin (StemCell Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... The following antibodies were used: DYKDDDDK Tag Antibody (D6W5B rabbit mAb #14793; Cell Signaling Technology; it binds to the same epitope as Sigma’s Anti-FLAG M2 Antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... The undigested tau fragments in each enzymatic reaction were determined by western blot analysis using anti-tau mAb ET3 (Espinoza et al., 2008) or anti-tau mAb RD4 (05-804, Millipore). For details ...
-
bioRxiv - Biochemistry 2022Quote: Two commercially available mAbs (immunoglobulin or IgG, type 1) were used for the fragmentation experiments: Sigma mAb standard (SiLuLite, IgG1 lambda, CHO, Sigma) and NIST mAb standard (HzIgG1 kappa ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-puromycin (12D10) mouse mAb (Millipore Sigma, MABE343). Secondary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... and mouse anti-β actin mAb (Sigma, USA). Goat anti-mouse IRD800-conjugated mAb (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... Goat anti-mouse IRD800-conjugated mAb (Sigma, USA) was used as secondary antibody for western blotting.
-
bioRxiv - Neuroscience 2019Quote: ... NeuN (mouse mAb clone A60, Millipore. 1:200), and anti-alpha-synuclein antibody MJFR1 (rabbit monoclonal ab138501 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse mAb anti-Flag M2 (Sigma-Aldrich #F1804); rabbit pAb anti-Flag (Sigma-Aldrich #F7425) ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated with mouse anti-phosphotyrosine mAb (4G10, Millipore) followed by AF488-goat- anti-mouse IgG2b (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... α-tubulin (T6199) mAb (Millipore-Sigma, San Louis, MO), anti-NM-IIA (H00004627-M03 ...
-
bioRxiv - Cell Biology 2021Quote: ... α-tubulin (T6199) mAb (Millipore-Sigma, San Louis, MO), anti-NM-IIA (H00004627-M03 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse mAb anti-vinculin (EMD Millipore VIIF9 (7F9), MAB3574 ...
-
bioRxiv - Cell Biology 2021Quote: ... beta-tubulin mouse mAb (1:300; Sigma T4026)
-
bioRxiv - Cancer Biology 2022Quote: ... anti-53BP1 (MAB 3802, Sigma-Aldrich, 1:300), anti-pDNA-PKcs Ser2056 (ab18192 ...
-
bioRxiv - Bioengineering 2022Quote: ... 60 µl of pre-diluted HIS.H8 mAb (Sigma) was applied onto the cells and incubated for 2 h under continuous agitation at room temperature in a moisturized chamber ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-β-actin mouse IgG mAb (Sigma-Aldrich); HRP-conjugated anti-mouse IgM mAb (Thermo Fisher Scientific ...